Skip to search formSkip to main content
You are currently offline. Some features of the site may not work correctly.

NOP58 gene

Known as: NOP58 ribonucleoprotein, HSPC120, NOP5, S. CEREVISIAE, HOMOLOG OF 
 
National Institutes of Health

Papers overview

Semantic Scholar uses AI to extract papers important to this topic.
2015
2015
Nop17 is a key R2TP factor for the assembly and maturation of box C/D snoRNP complex
BackgroundBox C/D snoRNPs are responsible for rRNA methylation and processing, and are formed by snoRNAs and four conserved… Expand
  • figure 1
  • figure 2
  • figure 3
  • figure 4
  • figure 5
Is this relevant?
2014
2014
Identification of discrete classes of small nucleolar RNA featuring different ends and RNA binding protein dependency
Small nucleolar RNAs (snoRNAs) are among the first discovered and most extensively studied group of small non-coding RNA. However… Expand
  • figure 1
  • figure 2
  • figure 3
  • figure 4
  • figure 5
Is this relevant?
2014
2014
RNA-Seq of the Nucleolus Reveals Abundant SNORD44-Derived Small RNAs
Small non-coding RNAs represent RNA species that are not translated to proteins, but which have diverse and broad functional… Expand
  • figure 1
  • figure 2
  • figure 3
  • figure 4
  • figure 5
Is this relevant?
Highly Cited
2010
Highly Cited
2010
A Proteomic Screen for Nucleolar SUMO Targets Shows SUMOylation Modulates the Function of Nop5/Nop58
Summary Posttranslational SUMO modification is an important mechanism of regulating protein function, especially in the cell… Expand
  • figure 1
  • table 1
  • table 2
  • figure 2
  • figure 3
Is this relevant?
2010
2010
A novel Nop5-sRNA interaction that is required for efficient archaeal box C/D sRNP formation.
Archaeal and eukaryotic box C/D RNPs catalyze the 2'-O-methylation of ribosomal RNA, a modification that is essential for the… Expand
  • figure 1
  • figure 2
  • figure 3
  • figure 4
Is this relevant?
2010
2010
The C-terminal Region of the Exosome-associated Protein Rrp47 Is Specifically Required for Box C/D Small Nucleolar RNA 3′-Maturation*
Cells lacking the exosome-associated protein Rrp47 show similar defects in stable RNA processing to those observed in the absence… Expand
  • figure 1
  • figure 2
  • figure 3
  • figure 4
  • figure 5
Is this relevant?
Highly Cited
2009
Highly Cited
2009
Structural organization of box C/D RNA-guided RNA methyltransferase
Box C/D guide RNAs are abundant noncoding RNAs that primarily function to direct the 2′-O-methylation of specific nucleotides by… Expand
  • figure 2
  • figure 1
  • figure 3
  • figure 5
  • figure 4
Is this relevant?
2006
2006
RNA Structural Requirements for the Association of the Spliceosomal hPrp31 Protein with the U4 and U4atac Small Nuclear Ribonucleoproteins*
The kink-turn, a stem I-internal loop-stem II structure of the 5 ′ stem-loop of U4 and U4atac small nuclear (sn) RNAs bound by 15… Expand
  • figure 1
  • figure 3
  • figure 2
  • figure 4
  • figure 5
Is this relevant?
Highly Cited
2002
Highly Cited
2002
Conserved Stem II of the Box C/D Motif Is Essential for Nucleolar Localization and Is Required, Along with the 15.5K Protein, for the Hierarchical Assembly of the Box C/D snoRNP
ABSTRACT The 5′ stem-loop of the U4 snRNA and the box C/D motif of the box C/D snoRNAs can both be folded into a similar stem… Expand
Is this relevant?
2002
2002
Conserved Stem II of the Box C / D Motif Is Essential for Nucleolar Localization and Is Required , Along with the 15 . 5 K Protein , for the Hierarchical Assembly of the Box C / D snoRNP
  • GCGGATCCCGGGTG TTTCATTCGCTCGGACATCCAAGGAAGGAACTAGC, GAAGATTCG CTGTGATGATGGATTCCAAAACCATTCG, +14 authors GCGGATCCCGGGTGTTTCATTCGCTCACGC ATCCAAGGAAGGAACTAGC
  • 2002
    • Corpus ID: 45385385
The 5 stem-loop of the U4 snRNA and the box C/D motif of the box C/D snoRNAs can both be folded into a similar stem-internal loop… Expand
  • figure 1
  • figure 2
  • figure 3
  • figure 4
  • figure 5
Is this relevant?
By clicking accept or continuing to use the site, you agree to the terms outlined in our Privacy Policy, Terms of Service, and Dataset License
ACCEPT & CONTINUE