Skip to search formSkip to main content
You are currently offline. Some features of the site may not work correctly.

NOP58 gene

Known as: NOP58 ribonucleoprotein, HSPC120, NOP5, S. CEREVISIAE, HOMOLOG OF 
 
National Institutes of Health

Papers overview

Semantic Scholar uses AI to extract papers important to this topic.
2015
2015
BackgroundBox C/D snoRNPs are responsible for rRNA methylation and processing, and are formed by snoRNAs and four conserved… Expand
  • figure 1
  • figure 2
  • figure 3
  • figure 4
  • figure 5
Is this relevant?
2014
2014
Small nucleolar RNAs (snoRNAs) are among the first discovered and most extensively studied group of small non-coding RNA. However… Expand
  • figure 1
  • figure 2
  • figure 3
  • figure 4
  • figure 5
Is this relevant?
2014
2014
Small non-coding RNAs represent RNA species that are not translated to proteins, but which have diverse and broad functional… Expand
  • figure 1
  • figure 2
  • figure 3
  • figure 4
  • figure 5
Is this relevant?
Highly Cited
2010
Highly Cited
2010
Summary Posttranslational SUMO modification is an important mechanism of regulating protein function, especially in the cell… Expand
  • figure 1
  • table 1
  • table 2
  • figure 2
  • figure 3
Is this relevant?
2010
2010
Archaeal and eukaryotic box C/D RNPs catalyze the 2'-O-methylation of ribosomal RNA, a modification that is essential for the… Expand
  • figure 1
  • figure 2
  • figure 3
  • figure 4
Is this relevant?
2010
2010
Cells lacking the exosome-associated protein Rrp47 show similar defects in stable RNA processing to those observed in the absence… Expand
  • figure 1
  • figure 2
  • figure 3
  • figure 4
  • figure 5
Is this relevant?
Highly Cited
2009
Highly Cited
2009
Box C/D guide RNAs are abundant noncoding RNAs that primarily function to direct the 2′-O-methylation of specific nucleotides by… Expand
  • figure 2
  • figure 1
  • figure 3
  • figure 5
  • figure 4
Is this relevant?
2006
2006
The kink-turn, a stem I-internal loop-stem II structure of the 5 ′ stem-loop of U4 and U4atac small nuclear (sn) RNAs bound by 15… Expand
  • figure 1
  • figure 3
  • figure 2
  • figure 4
  • figure 5
Is this relevant?
Highly Cited
2002
Highly Cited
2002
ABSTRACT The 5′ stem-loop of the U4 snRNA and the box C/D motif of the box C/D snoRNAs can both be folded into a similar stem… Expand
Is this relevant?
2002
2002
  • GCGGATCCCGGGTG TTTCATTCGCTCGGACATCCAAGGAAGGAACTAGC, GAAGATTCG CTGTGATGATGGATTCCAAAACCATTCG, +14 authors GCGGATCCCGGGTGTTTCATTCGCTCACGC ATCCAAGGAAGGAACTAGC
  • 2002
  • Corpus ID: 45385385
The 5 stem-loop of the U4 snRNA and the box C/D motif of the box C/D snoRNAs can both be folded into a similar stem-internal loop… Expand
  • figure 1
  • figure 2
  • figure 3
  • figure 4
  • figure 5
Is this relevant?