bekanamycin

Known as: aminodeoxykanamycin, kanamycin B, kanendomycin 
An aminoglycoside antibiotic derived from Streptomyces kanamyceticus, with antibacterial activity. Bekanamycin irreversibly binds to the bacterial… (More)
National Institutes of Health

Topic mentions per year

Topic mentions per year

1969-2018
0246819692018

Papers overview

Semantic Scholar uses AI to extract papers important to this topic.
2014
2014
Ribonuclease P (RNase P) is an essential endonuclease that catalyzes the 5' end maturation of precursor tRNA (pre-tRNA… (More)
  • figure 1
  • table 1
  • figure 2
  • figure 3
  • table 2
Is this relevant?
2011
2011
A selective kanamycin-binding single-strand DNA (ssDNA) aptamer (TGGGGGTTGAGGCTAAGCCGA) was discovered through in vitro selection… (More)
Is this relevant?
2006
2006
Aminoglycoside antibiotics inhibit several types of ribozymes, including group I introns, by displacing critical Mg2+ ions… (More)
Is this relevant?
2005
2005
Streptomyces tenebrarius is an industrially important microorganism, producing an antibiotic complex that mainly consists of the… (More)
  • figure 1
  • figure 2
  • figure 3
  • table 1
  • table 2
Is this relevant?
2005
2005
In an effort to optimize the antibacterial activity of kanamycin class aminoglycoside antibiotics, we have accomplished the… (More)
Is this relevant?
2005
2005
The 4,6-disubstituted 2-deoxystreptamines interfere with protein biosynthesis by specifically targeting the ribosomal A site… (More)
  • figure 1
  • table 1
  • figure 2
  • figure 3
  • figure 4
Is this relevant?
1997
1997
Aminoglycoside antibiotics interact with seemingly unrelated families of RNA molecules. They bind to 16S ribosomal RNA and… (More)
  • figure 1
  • figure 2
  • table 1
  • figure 3
Is this relevant?
1995
1995
Arbekacin (1-N-((S)-4-amino-2-hydroxybutyryl)-3',4'-dideoxykanamycin B) was active against 54 strains of methicillin-resistant… (More)
Is this relevant?
1980
1980
The ototoxicities of eight aminoglycoside antibiotics and fragments were measured quantitatively by cochlear perfusion in the… (More)
  • figure 1
  • figure 2
  • table 2
  • figure 3
Is this relevant?
1980
1980
The aminoglycoside antibiotics possess neuromuscular blocking activity; the potency of those antibiotics tested appears to be as… (More)
Is this relevant?