Skip to search formSkip to main content

miR-92b microrna, Drosophila

Known as: dme-mir-92b, miRNA 92b, Drosophila, microRNA92b, Drosophila 
 
National Institutes of Health

Papers overview

Semantic Scholar uses AI to extract papers important to this topic.
2019
2019
Wolbachia are endosymbiotic bacteria present in a wide range of invertebrates. Although their dramatic effects on host… Expand
Is this relevant?
2017
2017
rno-miR-29b-1 Forword GCCGCCTAGCACCATTTGAAATCAGTGTT 29 rno-miR-29b-1 Reverse GCGAGCACAGAATTAATACGAC 22 rno-miR-29b-2 Forword… Expand
  • table 1
Is this relevant?
2008
2008
La technique de filtrage particulaire s'applique a tous les problemes d'estimation des systemes dynamiques markoviens, sans… Expand
  • figure 2.1
  • figure 2.2
  • figure 2.3
  • figure 2.4
  • figure 2.5
Is this relevant?
2007
2007
MicroRNAs (miRNAs) are small regulatory molecules post-transcriptionally suppressing mRNA activity. Many miRNAs in various… Expand
  • table 1
  • table 2
  • figure 1
  • figure 2
  • figure 3
Is this relevant?
2007
2007
Le filtre particulaire "aleatoire", bien connu aujourd'hui, est base sur une interpretation par processus de branchement du… Expand
Is this relevant?
1997
1997
Dunnschichttransistor mit: einem Substrat (80, 90, 120, 200, 300); einer aktiven Schicht (21, 31, 31', 43, 82, 92, 101, 111, 121… Expand
Is this relevant?
Highly Cited
1994
Highly Cited
1994
Adopting the object-oriented paradigm for the development of large and complex software systems offers several advantages, of… Expand
  • figure 1.2
  • figure 1.3
  • figure 2.1
  • figure 2.2
  • figure 2.2
Is this relevant?
1993
1993
The TECHDOC system [R5sner, Stede 92b] is an implemented prototype that starts from a domain knowledge base about maintenance… Expand
Is this relevant?
1993
1993
In this paper, we propose a generalized diagnostic algorithm for the case where more than one fault (output and/or transfer) may… Expand
  • figure 1
  • figure 2
  • figure 3
  • figure 4
  • figure 5
Is this relevant?