Senecavirus A

Known as: Seneca Valley virus 
 

Topic mentions per year

Topic mentions per year

2007-2017
0102020072017

Papers overview

Semantic Scholar uses AI to extract papers important to this topic.
2016
2016
Senecavirus A (SV-A), formerly, Seneca Valley virus (SVV), has been detected in swine with vesicular lesions and is thought to be… (More)
  • figure 1
  • figure 2
  • figure 3
  • figure 4
  • figure 5
Is this relevant?
2016
2016
completed sequencing the whole genomes for the vesicle tissue (SVA-OH1) and vesicle swab sample (SVA-OH2). On the basis of BLAST… (More)
Is this relevant?
2016
2016
We performed a longitudinal field study in a swine breeding herd that presented with an outbreak of vesicular disease (VD) that… (More)
  • table 2
  • table 3
Is this relevant?
2016
2016
Senecavirus A (SVA) is an emerging picornavirus that has been associated with vesicular disease and neonatal mortality in swine… (More)
Is this relevant?
2016
2016
P339 gcgcTCTTCATTCAGCTCCTGTA Reverse 1571–1589 1,531 P340 CAGGGAGGCCTCAACGGAGG Forward 1393–1412 P341 ACGGCGTCCTTCTCCAGTACCTT… (More)
Is this relevant?
2016
2016
Senecavirus A has been infrequently associated with vesicular disease in swine since 1988. However, clinical disease has not been… (More)
  • figure 1
  • figure 2
Is this relevant?
2016
2016
Senecavirus A (SVA) is an emerging picornavirus that has been recently associated with an increased number of outbreaks of… (More)
  • table 1
  • table 2
  • table 4
Is this relevant?
2015
2015
Vesicular diseases are clinically and economically important infections that affect farm animals. North American studies have… (More)
Is this relevant?
2015
2015
BACKGROUND To determine the MTD of Seneca Valley Virus (NTX-010) in children with relapsed/refractory solid tumors. Patients (≥ 3… (More)
Is this relevant?
2012
2012
Seneca Valley virus (SVV), a member of the Picornaviridae family, was implicated in a suspicious vesicular disease discovered in… (More)
Is this relevant?