Skip to search formSkip to main content

RNA aptamer 58

Known as: APT58 aptamer 
 
National Institutes of Health

Papers overview

Semantic Scholar uses AI to extract papers important to this topic.
2018
2018
Cardiac troponin I (cTnI) is a specific and sensitive biomarker for the early diagnosis of acute myocardial infarction and for… Expand
  • figure 1
  • figure 2
  • figure 3
  • figure 4
Is this relevant?
2018
2018
The phylum Apicomplexa contains a group of protozoa causing diseases in humans and livestock. Plasmodium spp., the causative… Expand
  • figure 1
  • figure 2
  • figure 3
  • figure 4
  • figure 5
Is this relevant?
2017
2017
AbstractWe report a highly sensitive and selective strategy for Cd(II) assay using a singly labeled multifunctional probe… Expand
  • figure 1
  • figure 2
  • figure 3
  • figure 4
  • figure 5
Is this relevant?
2017
2017
Synthetic RNA-based systems have increasingly been used for the regulation of eukaryotic gene expression. Due to their structural… Expand
  • figure 2.1
  • figure 2.2
  • figure 2.3
  • figure 2.4
  • figure 2.5
Is this relevant?
2016
2016
An aptasensor was designed for the determination of aflatoxin M1 (AFM1) in milk based on DNA-aptamer recognition and… Expand
Is this relevant?
2015
2015
BackgroundWe have previously shown that serum levels of glyceraldehyde-derived advanced glycation end products (Gly-AGEs) are… Expand
  • figure 1
  • figure 2
  • figure 3
Is this relevant?
2015
2015
This paper describes a label-free and real-time piezoelectric aptasensor for the detection of cocaine. The acoustic wave sensing… Expand
Is this relevant?
2012
2012
A novel small molecule probe, aptamer beacon (AB), was introduced for adenosine (Ade) recognition and quantitative analysis. The… Expand
Is this relevant?
Highly Cited
2011
Highly Cited
2011
A selective kanamycin-binding single-strand DNA (ssDNA) aptamer (TGGGGGTTGAGGCTAAGCCGA) was discovered through in vitro selection… Expand
Is this relevant?
2008
2008
Small molecules are difficult to detect by conventional SPR technique directly because the changes in the refractive index… Expand
Is this relevant?