RNA 5' Terminal Oligopyrimidine Sequence

Known as: RNA 5' Terminal Oligopyrimidine Regulatory Sequence, 5' TOP Sequence, 5' TOP Sequences 
A regulatory sequence found in the 5' terminal regions of a variety of RNA species. The sequence starts with a CYTIDINE, which is followed by a… Expand
National Institutes of Health

Papers overview

Semantic Scholar uses AI to extract papers important to this topic.
2013
2013
The Ras/mitogen-activated protein kinase (MAPK) signalling cascade regulates various biological functions, including cell growth… Expand
  • figure 1
  • figure 2
  • figure 3
  • figure 4
  • figure 5
Is this relevant?
2012
2012
mTORC1 [mTOR (mammalian target of rapamycin) complex 1] regulates diverse cell functions. mTORC1 controls the phosphorylation of… Expand
  • figure 1
  • figure 2
  • table 1
  • figure 4
  • figure 3
Is this relevant?
Highly Cited
2011
Highly Cited
2011
The response of cells to changes in their environment often requires coregulation of gene networks, but little is known about how… Expand
  • figure 1
  • figure 2
  • figure 3
  • figure 4
  • figure 5
Is this relevant?
Review
2008
Review
2008
Triplex-forming oligonucleotides constitute an interesting DNA sequence-specific tool that can be used to target cleaving or… Expand
  • figure 1
  • figure 2
  • figure 3
  • figure 4
  • figure 5
Is this relevant?
Review
2006
Review
2006
Upon cell-cycle arrest or nutrient deprivation, the cellular rate of ribosome production is reduced significantly. In mammalian… Expand
  • figure 1
  • figure 2
Is this relevant?
Highly Cited
2000
Highly Cited
2000
In vertebrates, the mRNAs encoding ribosomal proteins, as well as other proteins implicated in translation, are characterized by… Expand
  • figure 1
  • figure 2
  • figure 3
  • figure 4
  • figure 5
Is this relevant?
Highly Cited
1997
Highly Cited
1997
TOP mRNAs are vertebrate transcripts which contain a 5'terminal oligopyrimidine tract (5'TOP), encode for ribosomal proteins and… Expand
  • figure 1
  • figure 2
  • figure 3
  • figure 5
  • figure 4
Is this relevant?
1996
1996
At slightly acidic or even neutral pH, oligodeoxyribonucleotides which include stretches of cytidines form a tetrameric structure… Expand
Is this relevant?
1990
1990
The 26mer oligodeoxynucleotide d(GAAGGAGGAGATTTTTCTCCTCCTTC) adopts in solution a unimolecular hairpin structure (h), with an… Expand
Is this relevant?
1990
1990
Several derivatives of pUC18 plasmid were constructed that contained oligopurine-oligopyrimidine (pur-pyr) motifs surrounded by… Expand
Is this relevant?