Skip to search formSkip to main content
You are currently offline. Some features of the site may not work correctly.

RNA 5' Terminal Oligopyrimidine Sequence

Known as: RNA 5' Terminal Oligopyrimidine Regulatory Sequence, 5' TOP Sequence, 5' TOP Sequences 
A regulatory sequence found in the 5' terminal regions of a variety of RNA species. The sequence starts with a CYTIDINE, which is followed by a… Expand
National Institutes of Health

Papers overview

Semantic Scholar uses AI to extract papers important to this topic.
Highly Cited
2017
Highly Cited
2017
The 5’terminal oligopyrimidine (5’TOP) motif is a cis-regulatory RNA element located immediately downstream of the 7… Expand
Is this relevant?
Highly Cited
2013
Highly Cited
2013
The Ras/mitogen-activated protein kinase (MAPK) signalling cascade regulates various biological functions, including cell growth… Expand
  • figure 1
  • figure 2
  • figure 3
  • figure 4
  • figure 5
Is this relevant?
Highly Cited
2012
Highly Cited
2012
mTORC1 [mTOR (mammalian target of rapamycin) complex 1] regulates diverse cell functions. mTORC1 controls the phosphorylation of… Expand
  • figure 1
  • figure 2
  • table 1
  • figure 4
  • figure 3
Is this relevant?
Highly Cited
2011
Highly Cited
2011
The response of cells to changes in their environment often requires coregulation of gene networks, but little is known about how… Expand
  • figure 1
  • figure 2
  • figure 3
  • figure 4
  • figure 5
Is this relevant?
Review
2008
Review
2008
Triplex-forming oligonucleotides constitute an interesting DNA sequence-specific tool that can be used to target cleaving or… Expand
  • figure 1
  • figure 2
  • figure 3
  • figure 4
  • figure 5
Is this relevant?
Review
2006
Review
2006
Upon cell-cycle arrest or nutrient deprivation, the cellular rate of ribosome production is reduced significantly. In mammalian… Expand
  • figure 1
  • figure 2
Is this relevant?
Highly Cited
2000
Highly Cited
2000
In vertebrates, the mRNAs encoding ribosomal proteins, as well as other proteins implicated in translation, are characterized by… Expand
  • figure 1
  • figure 2
  • figure 3
  • figure 4
  • figure 5
Is this relevant?
Highly Cited
1997
Highly Cited
1997
TOP mRNAs are vertebrate transcripts which contain a 5'terminal oligopyrimidine tract (5'TOP), encode for ribosomal proteins and… Expand
  • figure 1
  • figure 2
  • figure 3
  • figure 5
  • figure 4
Is this relevant?
Highly Cited
1996
Highly Cited
1996
At slightly acidic or even neutral pH, oligodeoxyribonucleotides which include stretches of cytidines form a tetrameric structure… Expand
Is this relevant?
Highly Cited
1990
Highly Cited
1990
The 26mer oligodeoxynucleotide d(GAAGGAGGAGATTTTTCTCCTCCTTC) adopts in solution a unimolecular hairpin structure (h), with an… Expand
Is this relevant?