Skip to search formSkip to main contentSkip to account menu
You are currently offline. Some features of the site may not work correctly.

RNA 5' Terminal Oligopyrimidine Sequence

Known as: RNA 5' Terminal Oligopyrimidine Regulatory Sequence, 5' TOP Sequence, 5' TOP Sequences 
A regulatory sequence found in the 5' terminal regions of a variety of RNA species. The sequence starts with a CYTIDINE, which is followed by a… Expand
National Institutes of Health

Papers overview

Semantic Scholar uses AI to extract papers important to this topic.
Highly Cited
Highly Cited
The 5’terminal oligopyrimidine (5’TOP) motif is a cis-regulatory RNA element located immediately downstream of the 7… Expand
Highly Cited
Highly Cited
The Ras/mitogen-activated protein kinase (MAPK) signalling cascade regulates various biological functions, including cell growth… Expand
  • figure 1
  • figure 2
  • figure 3
  • figure 4
  • figure 5
Highly Cited
Highly Cited
mTORC1 [mTOR (mammalian target of rapamycin) complex 1] regulates diverse cell functions. mTORC1 controls the phosphorylation of… Expand
  • figure 1
  • figure 2
  • table 1
  • figure 4
  • figure 3
Highly Cited
Highly Cited
The response of cells to changes in their environment often requires coregulation of gene networks, but little is known about how… Expand
  • figure 1
  • figure 2
  • figure 3
  • figure 4
  • figure 5
Triplex-forming oligonucleotides constitute an interesting DNA sequence-specific tool that can be used to target cleaving or… Expand
  • figure 1
  • figure 2
  • figure 3
  • figure 4
  • figure 5
Upon cell-cycle arrest or nutrient deprivation, the cellular rate of ribosome production is reduced significantly. In mammalian… Expand
  • figure 1
  • figure 2
Highly Cited
Highly Cited
In vertebrates, the mRNAs encoding ribosomal proteins, as well as other proteins implicated in translation, are characterized by… Expand
  • figure 1
  • figure 2
  • figure 3
  • figure 4
  • figure 5
Highly Cited
Highly Cited
TOP mRNAs are vertebrate transcripts which contain a 5'terminal oligopyrimidine tract (5'TOP), encode for ribosomal proteins and… Expand
  • figure 1
  • figure 2
  • figure 3
  • figure 5
  • figure 4
Highly Cited
Highly Cited
At slightly acidic or even neutral pH, oligodeoxyribonucleotides which include stretches of cytidines form a tetrameric structure… Expand
Highly Cited
Highly Cited
The 26mer oligodeoxynucleotide d(GAAGGAGGAGATTTTTCTCCTCCTTC) adopts in solution a unimolecular hairpin structure (h), with an… Expand