Skip to search formSkip to main content
You are currently offline. Some features of the site may not work correctly.

Protein Kinase C-Alpha Antisense

Known as: DNA, d(P-thio)(G-T-T-C-T-C-G-C-T-G-G-T-G-A-G-T-T-T-C-A), DNA, d(P-thio)(GTTCTCGCTGGTGAGTTTCA) 
 
National Institutes of Health

Papers overview

Semantic Scholar uses AI to extract papers important to this topic.
Highly Cited
2001
Highly Cited
2001
We derive type II supergravity solutions corresponding to space-filling regular and fractional Dp branes on (9 − p)-dimensional… Expand
Is this relevant?