Protein Kinase C-Alpha Antisense

Known as: DNA, d(P-thio)(G-T-T-C-T-C-G-C-T-G-G-T-G-A-G-T-T-T-C-A), DNA, d(P-thio)(GTTCTCGCTGGTGAGTTTCA) 
 
National Institutes of Health

Papers overview

Semantic Scholar uses AI to extract papers important to this topic.
2001
2001
We derive type II supergravity solutions corresponding to space-filling regular and fractional Dp branes on (9− p)-dimensional… (More)
Is this relevant?