Skip to search formSkip to main content
You are currently offline. Some features of the site may not work correctly.

CARD14 protein, human

Known as: CARD-MAGUK Protein 2, Bcl10-Interacting Maguk Protein 2, CARD-Containing MAGUK Protein 2 
Caspase recruitment domain-containing protein 14 (1004 aa, ~113 kDa) is encoded by the human CARD14 gene. This protein plays a role in the promotion… Expand
National Institutes of Health

Papers overview

Semantic Scholar uses AI to extract papers important to this topic.
Review
2017
Review
2017
The postsynaptic density (PSD) of all vertebrate species share a highly complex proteome with ~1000 conserved proteins that… Expand
  • figure 1
  • figure 2
  • figure 3
  • figure 4
Is this relevant?
2013
2013
Az Europai Unio egyik legnagyobb hatasu eszkoze – mind gazdasagi szempontbol, mind az atlagos unios polgar szemszogeből – a… Expand
Is this relevant?
2012
2012
Membrane-associated guanylate kinases (MAGUKs) are the major family of scaffolding proteins at the postsynaptic density. The PSD… Expand
  • figure 1
  • figure 2
  • figure 3
  • figure 4
Is this relevant?
Highly Cited
2010
Highly Cited
2010
Proteins of the PSD-95–like membrane-associated guanylate kinase (PSD-MAGUK) family are vital for trafficking AMPA receptors… Expand
  • figure 1
  • figure 2
  • figure 3
  • figure 4
  • figure 5
Is this relevant?
2010
2010
Im Rahmen des Forschungsprojektes WFF wurde das in CARMA begonnene Fahrzeug-Managementsystem weiterentwickelt. Teil des Systems… Expand
Is this relevant?
2010
2010
Das Dokument beschreibt zusammenfassend die Teilprojekte 3.1 und 3.3 des Verbundprojektes „Wettbewerbsfahiger Flughafen“ – WFF… Expand
Is this relevant?
Review
2009
Review
2009
Membrane associated guanylate kinase proteins (MAGUKs) play a key role in the regulation of the intracellular trafficking and… Expand
Is this relevant?
2007
2007
In our paper we incorrectly listed CTCTATTGTTCGACTGTATAT as an alternative PSD-93 shRNA targeting sequence. The correct… Expand
Is this relevant?
Highly Cited
2006
Highly Cited
2006
Trafficking of AMPA receptors (AMPA-Rs) to and from synapses controls the strength of excitatory synaptic transmission. However… Expand
  • figure 1
  • figure 2
  • figure 3
  • figure 4
  • figure 5
Is this relevant?