Using Algal Transcriptome Sequences to Identify Transferred Genes in the Sea Slug, Elysia chlorotica

Abstract

The first molecular evidence of horizontal gene transfer between multicellular eukaryotes was our discovery of the presence of three Vaucheria litorea nuclear-encoded genes [fucoxanthin chlorophyll a/c-binding protein (fcp) and light-harvesting complex 1 and 2 (Lhcv1 and 2)] in the genomic DNA of the sea slug, Elysia chlorotica, which are used to support… (More)
DOI: 10.1007/s11692-010-9079-2

Topics

9 Figures and Tables

Blog articles referencing this paper

Slides referencing similar topics

  • Genes encode proteins How to identify genes in new DNA ? Align it to things we know about already

    ATGACTAAATCTCATTCAGAAGAAGTGATTGTACCTGAGTTCAA TTCTAGCGCAAAGGAATTACCAAGACCATTGGCCGAAAAGTGCCCGAGCATAATTAAGAAATTTATAAGCGCTTATGATGCTAAACCGG ATTTTGTTGCTAGATCGCCTGGTAGAGTCAATCTAATTGGTGAACATATTGATTATTGTGACTTCTCGGTTTTACCTTTAGCTATTGAT TTTGATATGCTTTGCGCCGTCAAAGTTTTGAACGAGAAAAATCCATCCATTACCTTAATAAATGCTGATCCCAAATTTGCTCAAAGGAA GTTCGATTTGCCGTTGGACGGTTCTTATGTCACAATTGATCCTTCTGTGTCGGACTGGTCTAATTACTTTAAATGTGGTCTCCATGTTG CTCACTCTTTTCTAAAGAAACTTGCACCGGAAAGGTTTGCCAGTGCTCCTCTGGCCGGGCTGCAAGTCTTCTGTGAGGGTGATGTACCA ACTGGCAGTGGATTGTCTTCTTCGGCCGCATTCATTTGTGCCGTTGCTTTAGCTGTTGTTAAAGCGAATATGGGCCCTGGTTATCATAT GTCCAAGCAAAATTTAATGCGTATTACGGTCGTTGCAGAACATTATGTTGGTGTTAACAATGGCGGTATGGATCAGGCTGCCTCTGTTT GCGGTGAGGAAGATCATGCTCTATACGTTGAGTTCAAACCGCAGTTGAAGGCTACTCCGTTTAAATTTCCGCAATTAAAAAACCATGAA ATTAGCTTTGTTATTGCGAACACCCTTGTTGTATCTAACAAGTTTGAAACCGCCCCAACCAACTATAATTTAAGAGTGGTAGAAGTCAC TACAGCTGCAAATGTTTTAGCTGCCACGTACGGTGTTGTTTTACTTTCTGGAAAAGAAGGATCGAGCACGAATAAAGGTAATCTAAGAG ATTTCATGAACGTTTATTATGCCAGATATCACAACATTTCCACACCCTGGAACGGCGATATTGAATCCGGCATCGAACGGTTAACAAAG ATGCTAGTACTAGTTGAAGAGTCTCTCGCCAATAAGAAACAGGGCTTTAGTGTTGACGATGTCGCACAATCCTTGAATTGTTCTCGCGA AGAATTCACAAGAGACTACTTAACAACATCTCCAGTGAGATTTCAAGTCTTAAAGCTATATCAGAGGGCTAAGCATGTGTATTCTGAAT CTTTAAGAGTCTTGAAGGCTGTGAAATTAATGACTACAGCGAGCTTTACTGCCGACGAAGACTTTTTCAAGCAATTTGGTGCCTTGATG AACGAGTCTCAAGCTTCTTGCGATAAACTTTACGAATGTTCTTGTCCAGAGATTGACAAAATTTGTTCCATTGCTTTGTCAAATGGATC ATATGGTTCCCGTTTGACCGGAGCTGGCTGGGGTGGTTGTACTGTTCACTTGGTTCCAGGGGGCCCAAATGGCAACATAGAAAAGGTAA AAGAAGCCCTTGCCAATGAGTTCTACAAGGTCAAGTACCCTAAGATCACTGATGCTGAGCTAGAAAATGCTATCATCGTCTCTAAACCA GCATTGGGCAGCTGTCTATATGAATTATAA + 1 • Feb 12, 2016

  • De novo transcriptome assembly using Trinity

    Robert Bukowski + 1 • Oct 24, 2017

  • Identifying Important Genes in a Low‐energy Input Tree Crop Transcriptome Analysis of Breadfruit across a Domestication Gradient

    Kristen Laricchia • Jan 04, 2016