TrnR2, a Novel Receptor That Mediates Neurturin and GDNF Signaling through Ret

@article{Baloh1997TrnR2AN,
  title={TrnR2, a Novel Receptor That Mediates Neurturin and GDNF Signaling through Ret},
  author={Robert H Baloh and Mal{\'u} G. Tansey and Judith P. Golden and Douglas J. Creedon and Robert O Heuckeroth and Catherine L. Keck and Drazen B. Zimonjic and Nicholas C. Popescu and Eugene Malcolm Johnson and Jeffrey D. Milbrandt},
  journal={Neuron},
  year={1997},
  volume={18},
  pages={793-802}
}
Glial cell line-derived neurotrophic factor (GDNF) and neurturin (NTN) comprise a family of TGF-beta-related neurotrophic factors (TRNs), which have trophic influences on a variety of neuronal populations. A receptor complex comprised of TrnR1 (GDNFR alpha) and Ret was recently identified and found to be capable of mediating both GDNF and NTN signaling. We have identified a novel receptor based on homology to TrnR1, called TrnR2, that is 48% identical to TrnR1, and is located on the short arm… CONTINUE READING
Highly Influential
This paper has highly influenced 19 other papers. REVIEW HIGHLY INFLUENTIAL CITATIONS
120 Citations
42 References
Similar Papers

Citations

Publications citing this paper.
Showing 1-10 of 120 extracted citations

References

Publications referenced by this paper.
Showing 1-10 of 42 references

Similarities and nas, E., and Ibanez, C.F

  • N. Y. Ip, T. N. Stitt, +12 authors G. D. Yancopoulos
  • Werner syndrome. Genomics
  • 1993
Highly Influential
9 Excerpts

GDNF - induced activation of the ret protein chem

  • S. Jing, D. Wen, +12 authors G. M. Fox
  • 1996
Highly Influential
8 Excerpts

Dopaminergic 5 9 - TGGCACACCTCTGCTCTATG - 3 9 and reverse 5 9 - TGTTCCCAGGA neurons protected from degeneration by GDNF gene therapy

  • P. Chomczynski, N. Sacchi
  • 1997

Characterization of a multicomponent receptor

  • N. Asai, M. Takahashi, R. Vandlen, C. E. Henderson, A. Rosenthal
  • 1996

Similar Papers

Loading similar papers…