The orphan nuclear receptor NUR77 regulates hormone-induced StAR transcription in Leydig cells through cooperation with Ca2+/calmodulin-dependent protein kinase I.

@article{Martin2008TheON,
  title={The orphan nuclear receptor NUR77 regulates hormone-induced StAR transcription in Leydig cells through cooperation with Ca2+/calmodulin-dependent protein kinase I.},
  author={Luc J Martin and Nicolas Boucher and Catherine Brousseau and Jacques J. Tremblay},
  journal={Molecular endocrinology},
  year={2008},
  volume={22 9},
  pages={
          2021-37
        }
}
Cholesterol transport in the mitochondrial membrane, an essential step of steroid biosynthesis, is mediated by a protein complex containing the steroidogenic acute regulatory (StAR) protein. The importance of this transporter is underscored by mutations in the human StAR gene that cause lipoid congenital adrenal hyperplasia, male pseudohermaphroditism, and adrenal insufficiency. StAR transcription in steroidogenic cells is hormonally regulated and involves several transcription factors. The… CONTINUE READING
Highly Cited
This paper has 50 citations. REVIEW CITATIONS

Citations

Publications citing this paper.
Showing 1-10 of 28 extracted citations

A Cell-Autonomous Molecular Cascade Initiated by AMP-Activated Protein Kinase Represses Steroidogenesis

GCACCTCCGCGCCAAGAACT AAGCCCTCCTGCTCGTCGGT, CGTGCTCTTTAACCCAGACCT TCCATGCTGACTGCACCAAT, +6 authors GTTCCTCGCTACGTTCAAGC GAAACACCTTGCCCACATCT
2014
View 11 Excerpts
Method Support
Highly Influenced

fewer than 50 Citations

0510'10'13'16'19
Citations per Year
Semantic Scholar estimates that this publication has 50 citations based on the available data.

See our FAQ for additional information.