Temporal and dose-dependent hepatic gene expression patterns in mice provide new insights into TCDD-Mediated hepatotoxicity.

@article{Boverhof2005TemporalAD,
  title={Temporal and dose-dependent hepatic gene expression patterns in mice provide new insights into TCDD-Mediated hepatotoxicity.},
  author={D. R. Boverhof and L. D. Burgoon and Colleen Tashiro and Brock G Chittim and Jack R. Harkema and Donald B Jump and Timothy R. Zacharewski},
  journal={Toxicological sciences : an official journal of the Society of Toxicology},
  year={2005},
  volume={85 2},
  pages={1048-63}
}
In an effort to further characterize the mechanisms of 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD)-mediated toxicity, comprehensive temporal and dose-response microarray analyses were performed on hepatic tissue from immature ovariectomized C57BL/6 mice treated with TCDD. For temporal analysis, mice were gavaged with 30 microg/kg of TCDD or vehicle and sacrificed after 2, 4, 8, 12, 18, 24, 72, or 168 h. Dose-response mice were gavaged with 0, 0.001, 0.01, 0.1, 1, 10, 100, or 300 microg/kg of… CONTINUE READING

Citations

Publications citing this paper.
Showing 1-10 of 76 extracted citations

A Novel Nonconsensus Xenobiotic Response Element Capable of Mediating Aryl Hydrocarbon Receptor-Dependent Gene Expression

GTCCCAGCAAGTCACTGGGAGGGAGGGAGGGGGGGGAG CTCCCCCCCCTCCCTCCCTCCCAGTGACTTGCTGGGAC, GTCCTGAACGACCACTGGGAGGGAGGGAGGGGGGGGAG CTCCCCCCCCTCCCTCCCTCCCAGTGGTCGTTCAGGAC, +3 authors GTCCCAGCAAGTCACTGGGAGGGAAAGAGGGGGGGGAG CTCCCCCCCCTCTTTCCCTCCCAGTGACTTGCTGGGAC
2012
View 7 Excerpts
Highly Influenced

References

Publications referenced by this paper.
Showing 1-10 of 57 references

Gestational exposure of Ahr and Arnt hypomorphs to dioxin rescues vascular development.

Proceedings of the National Academy of Sciences of the United States of America • 2004
View 5 Excerpts
Highly Influenced

Primer3 on the WWW for general users and for biologist programmers.

Methods in molecular biology • 2000
View 2 Excerpts
Highly Influenced

Similar Papers

Loading similar papers…