Sequence Similarity of 12S Ribosomal Segment of Mitochondrial DNAs of Gharial and False Gharial

@inproceedings{Gatesy1992SequenceSO,
  title={Sequence Similarity of 12S Ribosomal Segment of Mitochondrial DNAs of Gharial and False Gharial},
  author={John Gatesy and George Amato},
  year={1992}
}

Citations

Publications citing this paper.
SHOWING 1-10 OF 21 CITATIONS

A time-calibrated species tree of Crocodylia reveals a recent radiation of the true crocodiles.

  • Jamie R Oaks
  • Biology, Medicine
  • Evolution; international journal of organic evolution
  • 2011
VIEW 3 EXCERPTS
CITES BACKGROUND
HIGHLY INFLUENCED

The rapid accumulation of consistent molecular support for intergeneric crocodylian relationships.

VIEW 7 EXCERPTS
CITES BACKGROUND

Comparisons of innate immune activity of all known living crocodylian species.

VIEW 6 EXCERPTS
CITES METHODS, BACKGROUND & RESULTS
HIGHLY INFLUENCED

Combined Support for Wholesale Taxic Atavism in Gavialine Crocodylians

  • CCCTCAGAATGATATTTGTCCTCA, RAGL, +5 authors TGCATTATAGCTTCCAGCTCATC
  • 2003
VIEW 4 EXCERPTS
CITES RESULTS & METHODS
HIGHLY INFLUENCED

Morphology, fossils, divergence timing, and the phylogenetic relationships of Gavialis.

VIEW 11 EXCERPTS
CITES METHODS & BACKGROUND
HIGHLY INFLUENCED