SOX10 mutations in chronic intestinal pseudo-obstruction suggest a complex physiopathological mechanism

@article{Pingault2002SOX10MI,
  title={SOX10 mutations in chronic intestinal pseudo-obstruction suggest a complex physiopathological mechanism},
  author={V. Pingault and M. Girard and N. Bondurand and H. Dorkins and L. van Maldergem and D. Mowat and T. Shimotake and I. Verma and C. Baumann and M. Goossens},
  journal={Human Genetics},
  year={2002},
  volume={111},
  pages={198-206}
}
  • V. Pingault, M. Girard, +7 authors M. Goossens
  • Published 2002
  • Biology, Medicine
  • Human Genetics
    • Abstract. The type IV Waardenburg syndrome (WS4), also referred to as Shah-Waardenburg syndrome or Waardenburg-Hirschsprung disease, is characterised by the association of Waardenburg features (WS, depigmentation and deafness) and the absence of enteric ganglia in the distal part of the intestine (Hirschsprung disease). Mutations in the EDN3, EDNRB, and SOX10 genes have been reported in this syndrome. Recently, a new SOX10 mutation was observed in a girl with a neural crest disorder without… CONTINUE READING
    View on Springer
    ncbi.nlm.nih.gov
    105 Citations
    Highly Influencial Citations
    6
    Background Citations
    36
    Methods Citations
    1
    Results Citations
    2
    105 Citations
    Citation Type

    Citation Type

    Waardenburg Syndrome Type IV De Novo SOX10 Variant Causing Chronic Intestinal Pseudo-Obstruction
    • 4
    • Highly Influenced
    • PDF
    Shah-Waardenburg syndrome and PCWH associated with SOX10 mutations: a case report and review of the literature.
    • J. Verheij, D. Sival, +4 authors A. V. van Essen
    • Medicine
    • European journal of paediatric neurology : EJPN : official journal of the European Paediatric Neurology Society
    • 2006
    • 46
    Chronic constipation recognized as a sign of a SOX10 mutation in a patient with Waardenburg syndrome.
    • 5
    Chronic intestinal pseudo‐obstruction in a child harboring a founder Hirschsprung RET mutation
    • 1
    Variants of the ACTG2 gene correlate with degree of severity and presence of megacystis in chronic intestinal pseudo-obstruction
    • 19
    • PDF
    Involvement of SOX10 in the pathogenesis of Hirschsprung disease: report of a truncating mutation in an isolated patient
    • 34
    • PDF
    Phenotypic similarities and differences in patients with a p.Met112Ile mutation in SOX10
    • 15
    Waardenburg syndrome: a rare cause of inherited neuropathy due to SOX10 mutation
    • 5
    Hirschsprung's disease as a model of complex genetic etiology.
    • 48
    • PDF
    A De Novo Novel Mutation of the EDNRB Gene in a Taiwanese Boy with Hirschsprung Disease
    • CAGTTCTTTTCTAGCCCGTG ATGATTCCCGTGTGTCTCCA, GTTTACACCAGCCCTGGAGC GCTCTGTCTGCCCCACAAGA, +10 authors CAGGAGTGTCTACAGCACTC CATTGCAGAGGGCTAGCACT
    • 2009
    • 5
    • PDF

    References

    SHOWING 1-10 OF 45 REFERENCES
    SOX10 mutations in patients with Waardenburg-Hirschsprung disease
    • 761
    Novel mutations of SOX10 suggest a dominant negative role in Waardenburg-Shah syndrome
    • 45
    • PDF
    Waardenburg syndrome.
    • 81
    • Highly Influential
    A molecular analysis of the yemenite deaf-blind hypopigmentation syndrome: SOX10 dysfunction causes different neurocristopathies.
    • 103
    • PDF
    A heterozygous endothelin 3 mutation in Waardenburg-Hirschsprung disease: is there a dosage effect ofEDN3/EDNRB gene mutations on neurocristopathy phenotypes?
    • 44
    Neurological phenotype in Waardenburg syndrome type 4 correlates with novel SOX10 truncating mutations and expression in developing brain.
    • 149
    Endothelin-3 Gene Mutations in Isolated and Syndromic Hirschsprung Disease
    • 95
    • Highly Influential
    Chronic Intestinal Pseudoobstruction Syndrome Clinical Analysis, Outcome, and Prognosis in 105 Children
    • 94
    • PDF
    Mutations in Hirschsprung Disease: When Does a Mutation Contribute to the Phenotype
    • 85
    Heterozygous endothelin receptor B (EDNRB) mutations in isolated Hirschsprung disease.
    • 187
    • PDF