Phylogeny and proposed circumscription of Breynia, Sauropus and Synostemon (Phyllanthaceae), based on chloroplast and nuclear DNA sequences

@article{Pruesapan2012PhylogenyAP,
  title={Phylogeny and proposed circumscription of Breynia, Sauropus and Synostemon (Phyllanthaceae), based on chloroplast and nuclear DNA sequences},
  author={Kanchana Pruesapan and Ian R. H. Telford and Jeremy J. Bruhl and Peter C. van Welzen},
  journal={Australian Systematic Botany},
  year={2012},
  volume={25},
  pages={313 - 330}
}
Previous estimates of phylogeny in the Phyllanthaceae, Phyllantheae, have been hampered by undersampling of species from morphologically distinctive groups and using too few gene regions. To increase the phylogenetic resolution, sequences of two nuclear (ITS1–5.8S–ITS2) and Phytochrome C (PHYC)) and two non-coding chloroplast (accD–psaI, trnS–trnG) DNA markers were analysed using maximum parsimony and Bayesian inference with expanded sampling in Breynia, Glochidion, Sauropus and Synostemon. Our… CONTINUE READING

Citations

Publications citing this paper.
SHOWING 1-10 OF 11 CITATIONS

References

Publications referenced by this paper.
SHOWING 1-10 OF 54 REFERENCES

Reverse: psaI-75R AGAAGCCATTGCAATTGCCGGAAA

Shaw
  • 2007
VIEW 10 EXCERPTS
HIGHLY INFLUENTIAL

Reverse: PHYC-R CCAGCTTCCATAAGGCTATCAGTACT

Samuel
  • 2005
VIEW 9 EXCERPTS
HIGHLY INFLUENTIAL

on the basis of matK and ITS. The trees presented here clearly indicate that Synostemon (Fig. 2, Clade B, PP 1.0, BP 100) is separate from Sauropus, whereas Sauropus forms a clade with Breynia

Pruesapan
  • BP
  • 2008
VIEW 6 EXCERPTS
HIGHLY INFLUENTIAL

A phylogenetic classification of Phyllanthaceae (Malpighiales; Euphorbiaceae sensu lato)

P Hoffmann, H Kathriarachchi, KJ Wurdack
  • Kew Bulletin
  • 2006
VIEW 8 EXCERPTS
HIGHLY INFLUENTIAL

Two subclades, C1 and C2, of Breynia s.lat. (Clade C, Fig. 2), are strongly supported. Subclade C1 comprises most species of Sauropus sect. Glochidioidei, S

Airy Shaw
  • sect. Sauropus and S. sect. Schizanthi and other unplaced species. Subclade C2 comprises S. sect. Cryptogynium and S. sect. Hemisauropus
  • 1969
VIEW 8 EXCERPTS
HIGHLY INFLUENTIAL