P167 Diagnostic accuracy of neutrophil-lymphocyte ratio in suspected paediatric inflammatory bowel disease.


s of the 12th Congress of ECCO – European Crohn’s and Colitis Organisation S161 type of colitis or neoplasia. All colonic biopsies were taken by colonoscopy. The histological remission was defined according Riley and Geboes index. The relative quantification of the gene expression was performed by real time PCR for FOX04: forward: cgagggactggacttcaact… (More)
DOI: 10.1093/ecco-jcc/jjx002.293


1 Figure or Table