Natural Foci of Tsutsugamushi Disease

Abstract

In recent years, the incidence of tsutsugamushi disease has increased in Nan Peng Lie Islands in China, and the disease has not been recorded in this region. The natural foci of tsutsugamushi disease were investigated in this paper. Isolation of Orientia tsutsugamushi and the study of preventive measures were also performed. The region was the island natural foci of south subtropical zone. The main host and vector were Rattus norvegicus and Leptotrombidium (L.) deliens respectively. The seasonal quantity trends of Rattus norvegicus and Leptotrombidium (L.) deliense were consistent with the incidence of human infection in the region. The strains of O. tsutsugamushi were isolated from Rattus norvegicus and Leptotrombidium (L.) deliense. The identification showed that most strains were Karp. The seroepidemiology showed a high prevalence of antibody against O. tsutsugamushi. After preventive measures were implemented, the incidence was descent. So Nan Peng Lie Islands were the natural foci of tsutsugamushi disease. Correspondence: Wang Shanshan, Medical Institute, Guangzhou Command PLA, Guangzhou 510507, People’s Republic of China. Tel: 0086-020-87702480-2021 SOUTHEAST ASIAN J TROP MED PUBLIC HEALTH Vol 32 No. 3 September 2001 542 MATERIALS AND METHODS Background of study sites Nan Peng Lie Islands are located at north latitude 23°12′~23°19′, east longitude 117°13′ ~117°19′. Nan Peng Lie Islands consisted of four islands. The climate of the area is south subtropical type. The average temperature is 21.5oC. The precipitation volume of yearly average is 1,331 mm. The relative humidity is 70-80%. Investigation of hosts The preponderant kind, seasonal variation, and ectoparasites of rats in the islands were investigated. Rats were captured in the east, west, south and north of the islands by mouse trapcages. The mouse trapcages were laid up at dusk and were taken back in the morning. The rats captured were killed, weighed, measured and species and sex identified. Each rat was searched thoroughly for ectoparasites and bled by intracardial puncture. The serum samples were stored at -20oC. The collected ectoparasites from rats were placed in cryotubes and stored in liquid nitrogen. From May 1998 to April 1999, rats were captured monthly for seasonal variation. The infecting rate of O. tsutsugamushi of the preponderant rat was determined by the isolation of O. tsutsugamushi. The kinds of sea birds on the islands were investigated. Three to five of each kind of sea birds were captured and sera and ectoparasites were collected. Meanwhile the sera and ectoparasites of domestic animals and fowl were also collected. Investigation of biological vectors The ectoparasites of the host were biologically distinguished. The preponderant trombiculid mite was determined. O. tsutsugamushi were isolated from the vectors. The seasonal variation of preponderant trombiculid mites was recorded at each month from May 1998 to April 1999. Isolation and identification of O.tsutsugamushi The spleen, kidney and liver of rats captured were aseptically collected. 0.5g of each of the above organs of 1~3 rats was ground in sterilized grinding bowl, while adding 2 ml pH7.4 0.2 M sucrose buffer containing 100 units/ml of penicillin and 20 μg/ml of amphotericin B. Each of 3 athymic nude mice was inoculated intraperitoneally with 0.5 ml of the above grinding liquid. Each pool consisting of 50~100 mites was homogenized with 1.5 ml of the above buffer, then 1.5 ml homogeneous liquid was inoculated into 3 athymic nude mice, which were observed thereafter for 4 weeks. When the mice became sick, their spleens were aseptically harvested. The infection of O. tsutsugamushi was confirmed by Giemsa stain. The methods of identification were (1) complement fixation test, (2) virulence: LD 50 , ID 50 , and (3) immune index. The Gilliam, Karp and Kato prototype O. tsutsugamushi strains were from Beijing Institute of Biological Products. Nested polymerase chain reaction (NPCR) DNA was amplified by means of NPCR. Three primers were selected from the DNA sequence of the gene encoding the serotypespecific 56-kDa protein gene of Karp, primer 1,5 ′GACAAGCTTCCTCAGCCTACTAT AATGCC 3′ (nt 395-424), primer 2, 5′CTAGA AGTTATAGCGTACACCTGCACTTGC 3′ (nt 1598-1569), primer 3, 5′CTAGGGATCCCGA CAGATGCACTATTAGGC 3′ (nt 931-902). 0.5 g of spleen and abdominal fluid of sick mice were respectively added 1 ml lysis buffer (10 mM Tris,10 mM EDTA,150 mM NaCl, 1% SDS,100 μg/ml proteinase), then kept at 50oC for 6 hours. DNA was extracted twice with phenol/chloroform, then precipitated in ethanol and used as template for NPCR. Briefly, the first amplification was carried out by primer 1 and primer 2. The second amplification was carried out by primer 1 and primer 3. All reactions were performed in a volume of 100 μl containing 10 x reaction buffer 10 μl (10 mM Tris-HCl, pH8.3, 2 mM MgCl 2 , 50 mM KCl), template DNA, 2.5 units of thermus aquaticus DNA polymerase and 200 μM each of dATP, dCTP, dGTP, dTTP. The amount of primer added to the reaction mixture NATURAL FOCI OF TSUTSUGAMUSHI DISEASE IN CHINA Vol 32 No. 3 September 2001 543 was 0.1 μM . The reaction was respectively carried out for 35 cycles in both the first and second amplifications. Briefly, the amplification conditions were heat denaturation at 94oC for 45 seconds, annealing at 58oC for 1 minute and extension at 72oC for 2 minutes. The PCR products were electrophoresed, then stained with ethidium bromide and observed under ultraviolet transillumination. When the 480~507 base pair specific band was detected, the sample was designated positive (Peng et al, 1999). Three prototype strains Gilliam, Karp, Kato were used as control. Restriction fragment length polymorphism (RFLP) The restriction endonucleases HincII and PstI were selected, referencing prototype O. tsutsugamushi strains Gilliam, Karp, Kato. When amplified products were digested with PstI, DNA of Karp became the fragments of 129 bp, 162 bp, 216 bp, DNA of Gilliam became the fragments of 123 bp, 357 bp.When amplified products were digested with HincII, DNA of Kato became the fragments of 173 bp, 307 bp (Peng et al, 1999).

1 Figure or Table

Cite this paper

@inproceedings{Peng2008NaturalFO, title={Natural Foci of Tsutsugamushi Disease}, author={Nan Peng and Guang Dong and Wang Shanshan}, year={2008} }