N- and C-terminal residues combine in the fusion-pH influenza hemagglutinin HA(2) subunit to form an N cap that terminates the triple-stranded coiled coil.

@article{Chen1999NAC,
  title={N- and C-terminal residues combine in the fusion-pH influenza hemagglutinin HA(2) subunit to form an N cap that terminates the triple-stranded coiled coil.},
  author={J. Chen and J. Skehel and D. Wiley},
  journal={Proceedings of the National Academy of Sciences of the United States of America},
  year={1999},
  volume={96 16},
  pages={
          8967-72
        }
}
  • J. Chen, J. Skehel, D. Wiley
  • Published 1999
  • Biology, Medicine
  • Proceedings of the National Academy of Sciences of the United States of America
  • The structure of a stable recombinant ectodomain of influenza hemagglutinin HA(2) subunit, EHA(2) (23-185), defined by proteolysis studies of the intact bacterial-expressed ectodomain, was determined to 1.9-A resolution by using x-ray crystallography. The structure reveals a domain composed of N- and C-terminal residues that form an N cap terminating both the N-terminal alpha-helix and the central coiled coil. The N cap is formed by a conserved sequence, and part of it is found in the neutral… CONTINUE READING
    259 Citations

    Figures, Tables, and Topics from this paper

    Functional Implications of the Human T-Lymphotropic Virus Type 1 Transmembrane Glycoprotein Helical Hairpin Structure
    • 43
    • Highly Influenced
    • PDF
    Inhibition of Murine Leukemia Virus Envelope Protein ( Env ) Processing by Intracellular Expression of the Env N-Terminal Heptad Repeat Region
    • CCGGTTATCAAGCGTAATCTGGAACA TCGTATGGGTACGGTAC, CTCTAACCT, Ga., AAGTCTCCCACTTCCCTGTCTG
    • 2005
    • PDF
    Structure of the HIV-1 gp41 membrane-proximal ectodomain region in a putative prefusion conformation.
    • 65
    • PDF
    Synthetic fusion peptides of tick-borne encephalitis virus as models for membrane fusion.
    • 22
    • PDF

    References

    SHOWING 1-10 OF 69 REFERENCES
    Core structure of the envelope glycoprotein GP2 from Ebola virus at 1.9-A resolution.
    • 237
    • PDF
    A soluble domain of the membrane-anchoring chain of influenza virus hemagglutinin (HA2) folds in Escherichia coli into the low-pH-induced conformation.
    • J. Chen, S. Wharton, +4 authors D. Wiley
    • Chemistry, Medicine
    • Proceedings of the National Academy of Sciences of the United States of America
    • 1995
    • 143
    • PDF
    Atomic structure of a thermostable subdomain of HIV-1 gp41.
    • 526
    • PDF
    Studies on the primary structure of the influenza virus hemagglutinin.
    • J. Skehel, M. Waterfield
    • Biology, Medicine
    • Proceedings of the National Academy of Sciences of the United States of America
    • 1975
    • 227
    • PDF
    Studies on the structure of the influenza virus haemagglutinin at the pH of membrane fusion.
    • 147