Mutational spectrum of the iduronate 2 sulfatase gene in 25 unrelated Korean Hunter syndrome patients: identification of 13 novel mutations.

Abstract

Hunter syndrome (Mucopolysaccharidosis type II, MPS2) is an X-linked recessively inherited disease caused by a deficiency of iduronate 2 sulfatase (IDS). In this study, we investigated mutations of the IDS gene in 25 Korean Hunter syndrome patients. We identified 20 mutations, of which 13 mutations are novel; 6 small deletions (69_88delCCTCGGATCCGAAACGCAGG… (More)

Topics

Cite this paper

@article{Kim2003MutationalSO, title={Mutational spectrum of the iduronate 2 sulfatase gene in 25 unrelated Korean Hunter syndrome patients: identification of 13 novel mutations.}, author={Chi Hwa Kim and Hye Zin Hwang and Seng Mi Song and Kyung Hoon Paik and Eun Kyung Kwon and Kwang Bin Moon and Jeong Hyeok Yoon and Cheol Kyu Han and D. M. Jin}, journal={Human mutation}, year={2003}, volume={21 4}, pages={449-50} }