Molecular dynamics simulations of an oligonucleotide duplex with adenine tracts phased by a full helix turn.

@article{Young1998MolecularDS,
  title={Molecular dynamics simulations of an oligonucleotide duplex with adenine tracts phased by a full helix turn.},
  author={Matthew A. Young and David L. Beveridge},
  journal={Journal of molecular biology},
  year={1998},
  volume={281 4},
  pages={675-87}
}
A theoretical model of a DNA oligonucleotide duplex featuring A-tracts phased by a full helix turn is developed based on molecular dynamics computer simulation. The extent to which this model agrees with relevant experimental data on axis bending and the relationship of A-tracts to bending and other aspects of helix morphology is investigated. Specifically, a series of nanosecond-level molecular dynamics (MD) simulations have been carried out for the 25 bp duplex d(ATAGGCAAAAAATAGGCAAAAATGG) at… CONTINUE READING

Citations

Publications citing this paper.
Showing 1-10 of 28 extracted citations

References

Publications referenced by this paper.
Showing 1-10 of 69 references

Molecular dynamics simulations on solvated biomolecular systems: the particle mesh Ewald method leads to stable trajectories of DNA, RNA, and proteins

  • T. E. Cheatham, III, J. L. Miller, T. Fox, T. A. Darden, P. A. Kollman
  • J. Am. Chem. Soc. 117,
  • 1995
Highly Influential
3 Excerpts

Transferable intermolecular potential functions for water, alcohols and ethers. Application to liquid water

  • W. L. Jorgensen
  • J. Am. Chem
  • 1981
Highly Influential
2 Excerpts

Modeling of DNA via molecular dynamics simulation: structure, bending, and conformational transitions

  • D. L. Beveridge, M. A. Young, D. Sprous
  • In Molecular Modeling of Nucleic Acids (Leontis,
  • 1998
1 Excerpt

Similar Papers

Loading similar papers…