Making DNA Add

@article{Guarnieri1996MakingDA,
  title={Making DNA Add},
  author={Frank Guarnieri and M S Fliss and Carter Bancroft},
  journal={Science},
  year={1996},
  volume={273},
  pages={220 - 223}
}
Recent studies have demonstrated the feasibility of using DNA-based experiments to compute solutions to combinatorial problems. However, a prerequisite for designing a computer useful in a wide range of applications is the ability to perform mathematical calculations. The development of a DNA-based algorithm for addition is presented. The DNA representation of two nonnegative binary numbers is presented in a form permitting a chain of primer extension reactions to carry out the addition… Expand
Arithmetic and logic operations with DNA
TLDR
A fixed bit encoding scheme is presented, modeling the input/output mechanisms of an electronic computer, and it is shown how a sequence of such operations can be executed in a single test tube producing a unique result. Expand
Using DNA to solve the Bounded Post Correspondence Problem
TLDR
This paper proposes a DNA algorithm for an NP-complete problem, The Bounded Post Correspondence Problem, which can be used to test several standard molecular biology laboratory procedures for their usability as bio-operations in DNA computing. Expand
Parallel Function Application on a DNA Substrate
TLDR
A new model that employs a biological (specifically DNA -based) substrate for performing computation and discusses some direct algorithms for computing a variety of useful mathematical functions on DNA, culminating in an algorithm for minimizing an arbitrary continuous function. Expand
A Comprehensive DNA Arithmetic Calculator
TLDR
A simple procedure that allows DNA-based bit arithmetic calculations is presented and it is shown that either iterative or parallel operations are permissible. Expand
DNA addition using linear self-assembly
This paper presents a DNA algorithm which adds two nonnegative binary integers using self-assembly in constant steps. The approach has the benefit of greater experimental simplicity when comparedExpand
A conventional strands evaluator for DNA computations
TLDR
This paper presents an intermediate tool between strand logical design and practical computations, that allows scientists to approach in-vitro computations reducing the probability of biological mistakes in the phase of theoretical input design for practical computation. Expand
Recent Developments in DNA-Computing
In 1994 Adleman published the description of a lab experiment, where he computed an instance of the Hamiltonian path problem with DNA in test tubes. He initiated a flood of further research onExpand
Simulating DNA Computing
TLDR
The simulation serves as an educational tool to teach DNA computing without the elaborate bio-experiments and digitally verifies Adleman's notion of DNA computing to solve the Hamiltonian path problem. Expand
DNA-based Parallel Computation of Simple Arithmetic
TLDR
A model for representing and manipulating binary numbers on a DNA chip which allows parallel execution of simple arithmetic and how addition of large binary numbers can be done by using a DNAChip is proposed. Expand
A DNA Arithmetic Logic Unit
TLDR
In vitro algorithms using Dna strands to perform arithmetic and logical operations and use the same Dna structure to implement each algorithm, as well as to represent inputs and outputs are proposed. Expand
...
1
2
3
4
5
...

References

SHOWING 1-9 OF 9 REFERENCES
DNA solution of hard computational problems.
  • R. Lipton
  • Computer Science, Medicine
  • Science
  • 1995
TLDR
DNA experiments are proposed to solve the famous "SAT" problem of computer science and have the potential to yield vast speedups over conventional electronic-based computers for such search problems. Expand
Molecular computation of solutions to combinatorial problems.
TLDR
This experiment demonstrates the feasibility of carrying out computations at the molecular level by solving an instance of the directed Hamiltonian path problem with standard protocols and enzymes. Expand
Thyrotropin-releasing hormone action on the prolactin promoter is mediated by the POU protein pit-1.
TLDR
TRH response elements (TRHREs) in the promoter region of the rat PRL gene and the gene-proximal protein that transmits the TRH signal to these elements are characterized. Expand
Maya Blue Paint: An Ancient Nanostructured Material
TLDR
High-resolution transmission electron microscopy, electron energy loss spectroscopy, and x-ray microanalysis studies of authentic samples show that palygorskite crystals in the paint form a superlattice that probably occurs as a result of mixing with indigo molecules. Expand
More recent x-ray diffraction measurements to pressures have revealed additional structural information but are consistent with the persistence of a structure
  • Nature
  • 1987
Museo Nacional de Antropologia, Instituto Nacional de Antropologia e Historia, Paseo de la Reforma y Gandhi s/n
    Supported by funds provided by The Mount Sinai School of Medicine. We thank an anonymous reviewer for helpful comments on the manuscript
      The elements illustrated in Fig. 3 were represented by the following sequences (all listed 5' to 3') or the appropriate complementary sequence (or both): 0, CCTTACCCCTTTCTACCTCT; DEF
      • TCGTCTCAG-GGGGGGTGCTT