Linkage mapping of chicken ovoinhibitor and ovomucoid genes to chromosome 13.

@article{Kinoshita2004LinkageMO,
  title={Linkage mapping of chicken ovoinhibitor and ovomucoid genes to chromosome 13.},
  author={Kazuya Kinoshita and Takeshi Shimogiri and Shunsuke Okamoto and Komei Yoshizawa and Hideyuki Mannen and Hisham Radwan Ibrahim and Hans H. Cheng and Yoshimi Maeda},
  journal={Animal genetics},
  year={2004},
  volume={35 4},
  pages={
          356-8
        }
}
DogBAC canine BAC library (http://www.dogmap.ch/) was polymerase chain reaction (PCR)-screened. Primers were designed using canine mRNA sequence GenBank accession no. U62093 (primer UP: GACTGAGTACAAACTGGTGG and primer LO: GGGCCTCACCTCTATGGTG). The PCR conditions were established on canine blood genomic DNA, the corresponding PCR product cloned and verified by sequencing. The positive BAC clone (DogBAC library ID S050P24H09) was verified by PCR and sequencing. 
BETA

References

Publications referenced by this paper.
SHOWING 1-2 OF 2 REFERENCES

Biological Chemistry Hoppe-Seyler 365, 51–4

  • F Tan
  • Correspondence: Yoshizane Maeda (maeda@agri…
  • 1988

Similar Papers

Loading similar papers…