Linkage analysis in spinopontine atrophy: correlation of HLA linkage with phenotypic findings in hereditary ataxia.

Abstract

Because linkage has been reported between HLA and the locus for hereditary ataxia in some families, we studied a 3-generation kindred in which several individuals had dominantly inherited spinopontine atrophy. Affected family members had upper and lower limb ataxia, hypoactive reflexes, loss of proprioception, dysarthria, dysphagia, and pronounced… (More)

Topics

Figures and Tables

Sorry, we couldn't extract any figures or tables for this paper.

Slides referencing similar topics

  • Sporadic ataxia and multiple system atrophy

    Sid Gilman • Sep 28, 2016

  • Genetic Linkage Analysis

    Su-In Lee + 1 • Jul 15, 2015

  • Linkage / Haplotypes • Linkage disequilibrium • Allele correlations • Application : Linkage and association studies Law of independent assortment

    ATGCCGATCGTACGACACATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCATCGTACTGACTGCATC TACTGACTGCATCGTACTGACTGCACATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCCACATATCG CATCGTACTGACTGTCTAGTCTAAACACATCCCACATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCC CATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCTATGCCGATCGTACGACACATATCGTCATCGTAC ACTGTCTAGTCTAAACACATCCATCGTACTGACTGCATCGTACTGACTGCATCGTACTGACTGCACATATCGTCA TCGTACTGACTGTCTAGTCTAAACACATCCCACATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCCA ATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCCACATATCGTCATCGTACTGACTGTCTAGTCTAAA GCCGATCGTACGACACATATCGTCATCGTACTGCCCTACGGGACTGTCTAGTCTAAACACATCCATCGTACTGA TGACTGCATCGTACTGACTGCACATATCGTCATACATAGACTTCGTACTGACTGTCTAGTCTAAACACATCCCA CGTACTGACTGTCTAGTCTAAACACATCCCACTTTACCCATGCATCGTACTGACTGTCTAGTCTAAACACATCC ATCGTACTGACTGTCTAGTCTAAACACATCCCAGCATCCATCCATATCGTCATCGTACTGACTGTCTAGTCTAAA GCCGATCGTACGACACATATCGTCATCGTACTGCCCTACGGGACTGTCTAGTCTAAACACATCCATCGTACTGA TGACTGCATCGTACTGACTGCACATATCGTCATACATAGACTTCGTACTGACTGTCTAGTCTAAACACATCCCA CGTACTGACTGTCTAGTCTAAACACATCCCACTTTACCCATGATATCGTCATCGTACTGACTGTCTAGTCTAAA + 3 • Aug 11, 2017