Intron targeting-mediated and endogenous gene integrity-maintaining knockin in zebrafish using the CRISPR/Cas9 system

@inproceedings{Li2015IntronTA,
  title={Intron targeting-mediated and endogenous gene integrity-maintaining knockin in zebrafish using the CRISPR/Cas9 system},
  author={Jia Li and Bai-bing Zhang and Yong-gang Ren and Shan-ye Gu and Yuan-hang Xiang and Jiu-lin Du},
  booktitle={Cell Research},
  year={2015}
}
sgRNA cleavage efficiency at the th locus (10/12) CTTTCTCCCCTTTATGAGTGTAACAACCCCTGGGT WT × 2 CTTTCTCCCTTCTCCCCCGGC——————GAGTGTAA——TGACCCCTGGGT +6 (Δ8, +14) CTTTCTCTCCC—————TGAGTGTAACAACCCCTGGGT Δ3 (Δ5, +2) CTTTCTCCCCTTTTTTTTTTT——GAGTGTAACAACCCCTGGGT +6 (Δ2, +8) CTTTCTCCCCTTGAGAA—ATTATGAGTGTAACAACCCCTGGGT +4 (Δ1,+5) × 2 CTTTCTCCCCT———TGAGTGTAACAACCCCTGGGT Δ3 × 2 CTTTCTCCCCT—————————TAACAACCCCTGGGT Δ9 × 3 sgRNA cleavage efficiency at the tph2 locus (7/11) AGAAAACCTGAGCATACTGACTGAGAGGTGTTTCAA WT… CONTINUE READING
Related Discussions
This paper has been referenced on Twitter 2 times. VIEW TWEETS

From This Paper

Topics from this paper.

Citations

Publications citing this paper.
Showing 1-10 of 28 extracted citations

In vivo genome editing thrives with diversified CRISPR technologies

Zoological research • 2018
View 8 Excerpts
Highly Influenced

References

Publications referenced by this paper.
Showing 1-2 of 2 references

Nat Biotechnol Int J Biol Sci

Y Fu, Ja Foden, C Khayter
Nat Biotechnol Int J Biol Sci • 2010

Nat Rev Genet Nat Biotechnol Nature Cell Res Nat Biotechnol Nat Methods Gen Res Scientific Rep PloS One Dev Biol

Mr Capecchi, P Huang, A Xiao, M Zhou
Nat Rev Genet Nat Biotechnol Nature Cell Res Nat Biotechnol Nat Methods Gen Res Scientific Rep PloS One Dev Biol • 2005

Similar Papers

Loading similar papers…