Identification of a novel DPB1* allele (DPB1*6901) and the occurrence of HLA haplotypes that extend to DPB1.

Abstract

The sequence of a novel DPB1 allele, DPB1*6901, observed in a Caucasian bone marrow donor phenotype HLA A2; Cw*0501,*1601; B*4402, *4403; DRB1*0401; *07; DQB1*02; *0301; DPB1*0401; *6901, is described. The sequence is consistent with that previously described for DPB1*0601 with the exception of codon 69. The sequence at this codon is consistent with that… (More)

Topics

Figures and Tables

Sorry, we couldn't extract any figures or tables for this paper.

Slides referencing similar topics

  • HLA Nomenclature: Allele Names

    Steve Spellman • Oct 19, 2017

  • Classical HLA alleles

    Xiaoming Jia • Oct 21, 2017

  • Linkage / Haplotypes • Linkage disequilibrium • Allele correlations • Application : Linkage and association studies Law of independent assortment

    ATGCCGATCGTACGACACATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCATCGTACTGACTGCATC TACTGACTGCATCGTACTGACTGCACATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCCACATATCG CATCGTACTGACTGTCTAGTCTAAACACATCCCACATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCC CATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCTATGCCGATCGTACGACACATATCGTCATCGTAC ACTGTCTAGTCTAAACACATCCATCGTACTGACTGCATCGTACTGACTGCATCGTACTGACTGCACATATCGTCA TCGTACTGACTGTCTAGTCTAAACACATCCCACATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCCA ATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCCACATATCGTCATCGTACTGACTGTCTAGTCTAAA GCCGATCGTACGACACATATCGTCATCGTACTGCCCTACGGGACTGTCTAGTCTAAACACATCCATCGTACTGA TGACTGCATCGTACTGACTGCACATATCGTCATACATAGACTTCGTACTGACTGTCTAGTCTAAACACATCCCA CGTACTGACTGTCTAGTCTAAACACATCCCACTTTACCCATGCATCGTACTGACTGTCTAGTCTAAACACATCC ATCGTACTGACTGTCTAGTCTAAACACATCCCAGCATCCATCCATATCGTCATCGTACTGACTGTCTAGTCTAAA GCCGATCGTACGACACATATCGTCATCGTACTGCCCTACGGGACTGTCTAGTCTAAACACATCCATCGTACTGA TGACTGCATCGTACTGACTGCACATATCGTCATACATAGACTTCGTACTGACTGTCTAGTCTAAACACATCCCA CGTACTGACTGTCTAGTCTAAACACATCCCACTTTACCCATGATATCGTCATCGTACTGACTGTCTAGTCTAAA + 3 • Aug 11, 2017