Identification of a Bombyx mori gene encoding small heat shock protein BmHsp27.4 expressed in response to high-temperature stress.

@article{Wang2014IdentificationOA,
  title={Identification of a Bombyx mori gene encoding small heat shock protein BmHsp27.4 expressed in response to high-temperature stress.},
  author={Hua Wang and Yan Fang and Zhongzan Bao and X. Jin and Wenjuan Zhu and Lipeng Wang and Teng Liu and Haipeng Ji and Haiying Wang and Shi-Qing Xu and Y. Sima},
  journal={Gene},
  year={2014},
  volume={538 1},
  pages={
          56-62
        }
}
Elucidating the mechanisms underlying the response and resistance to high-temperature stress in the Lepidoptera is essential for understanding the effect of high-temperature on the regulation of gene expression. A tag (CATGAACGTGAAGAGATTCAG) matching the predicted gene BGIBMGA005823-TA in SilkDB identified the most significant response to high-temperature stress in a screen of the heat-treated digital gene expression library of Bombyx mori (B. mori) (Unpublished data). BLAST and RACE showed… Expand
Analysis of transcripts of heat shock protein genes in silkworm, Bombyx mori (Lepidoptera: Bombycidae).
TLDR
SK4C is identified as a bivoltine breed, which is highly tolerant of high temperature measured in terms of percentage pupation (of the bIVoltine breeds) and higher levels of expression of Hsp genes compared to CSR2. Expand
Cloning & sequence identification of Hsp27 gene and expression analysis of the protein on thermal stress in Lucilia cuprina
TLDR
It is inferred that Lchsp27 may have significant role in the maintenance of cellular homeostasis, particularly, during summer months, when the fly remains exposed to high heat in its natural habitat. Expand
Molecular cloning and functional analysis of small heat shock protein 19.1 gene from the Chinese oak silkworm, Antheraea pernyi.
TLDR
The identified and characterized the full-length cDNA encoding sHSP 19.1 from the oak silkworm, Antheraea pernyi, and found that it plays a crucial role in immune responses and thermal tolerance in A.pernyi. Expand
Constitutive Expression of a Tomato Small Heat Shock Protein Gene LeHSP21 Improves Tolerance to High-Temperature Stress by Enhancing Antioxidation Capacity in Tobacco
TLDR
The results presented here demonstrate the feasibility of improving high temperature and oxidative stress tolerance in plants through the expression of LeHSP21 gene. Expand
Overexpression of Bmhsp19.9 protects BmE cells and transgenic silkworm against extreme temperatures.
TLDR
Overexpression of Bmhsp19.9 increased the resistance of transgenic silkworms to extreme temperatures, which may be useful for sericulture in regions and seasons with no optimal average temperatures for silkworm. Expand
Transcriptome analysis of the Bombyx mori fat body after constant high temperature treatment shows differences between the sexes
TLDR
There were significant changes to the gene expression in the fat body after heat treatment, especially in binding, catalytic, cellular and metabolic processes, and differences were observed between male and female fat bodies in the expression of RPS2, RPL37A and MREL. Expand
Identification and Expression Analysis of Four Small Heat Shock Protein Genes in Cigarette Beetle, Lasioderma serricorne (Fabricius)
TLDR
The results suggest that different LsHsp genes play important and distinct regulatory roles in L. serricorne development and in response to diverse stresses. Expand
Identification and characterization of heat shock proteins in a parasitic wasp Chouioia cuneae (Hymenoptera: Eulophidae)
TLDR
Insight is provided into the response of C. cunea to abiotic stresses and insight into the use of this parasitoid in biological control strategies is provided. Expand
Characterization, expression profiling, and thermal tolerance analysis of heat shock protein 70 in pine sawyer beetle, Monochamus alternatus hope (Coleoptera: Cerambycidae)
TLDR
Findings unraveled HSP70s might be the intrinsic mediators of the strong heat tolerance of M. alternatus due to their stabilized structure and bioactivity. Expand
Characteristics of six small heat shock protein genes from Bactrocera dorsalis: Diverse expression under conditions of thermal stress and normal growth.
TLDR
Functional differentiation within the sHsp subfamily in B. dorsalis is strongly suggested, and significant tissue specificity exists among sHsps: the highest expression of BdHsp20.6 and BDHsp23.8 in the Malpighian tubules and ovary, respectively, versus a peak in the fat body for others. Expand
...
1
2
...

References

SHOWING 1-10 OF 27 REFERENCES
Cloning, Expression, and Cell Localization of a Novel Small Heat Shock Protein Gene: BmHSP25.4
TLDR
Results of above studies have indicated constitutive expression of BmHSP25.4 in fatty body, blood tissues, and Bm5 cells. Expand
Comparative analysis on the expression of inducible HSPs in the silkworm, Bombyx mori
TLDR
There was significant difference between responses of severe and mild heat shocks after 4 h heat recovery, and Nistari breed as a naturally thermo-tolerant breed was expressed lower HSPs than a therMO-sensitive breed. Expand
Three heat shock proteins from Spodoptera exigua: Gene cloning, characterization and comparative stress response during heat and cold shocks.
TLDR
The results revealed that long-term shocking can affect SexHSP74 and sexHSP83 expression and long- term cooling can influence SexH SP83 expression during the recovery stage. Expand
Genes Encoding Small Heat Shock Proteins of the Silkworm, Bombyx mori
TLDR
The deduced amino acid sequence of sHSP21.4 was similar to that of Drosophila melanogaster CG14207-PA and, in a phylogenetic tree, formed a cluster including Plodia interpunctella αCP25. Expand
A Plant Small Heat Shock Protein Gene Expressed during Zygotic Embryogenesis but Noninducible by Heat Stress*
TLDR
The results show an evolutionary divergence, in the regulation of plant sHSP genes, which has originated stress-responsive genes and nonresponsive members within this gene family. Expand
The small heat shock protein (sHSP) genes in the silkworm, Bombyx mori, and comparative analysis with other insect sHSP genes
TLDR
Comparison of insect sHSPs from B. mori, Drosophila melanogaster, Apis mellifera, Tribolium castaneum, and Anopheles gambiae revealed that there is only one orthologous cluster whereas remaining clusters are species-specific on the phylogenetic tree, suggesting that most of sH SPs might have diverged in function across insects investigated. Expand
Characterization of the cDNA encoding the 90 kDa heat-shock protein in the Lepidoptera Bombyx mori and Spodoptera frugiperda.
TLDR
It is shown that, unlike the vertebrates, hsp90 is a unique gene in both S. frupiperda and B. mori genomes, andylogenetic analysis based on the two lepidopteran and 23 other HSP90 aa sequences displays a high consistency with known phylogeny at both high and low taxonomic levels. Expand
Impact of temperature on heat shock protein expression of Bombyx mori cross-breed and effect on commercial traits.
TLDR
Resistance to heat shock was increased as larval development proceeds and increased thermotolerance is achieved with the induction of Heat shock protein 72 in the Vth instar larval haemolymph. Expand
Microarray analysis of the gene expression profile in the midgut of silkworm infected with cytoplasmic polyhedrosis virus
TLDR
The results suggest that BmCPV infection resulted in the disturbance of protein and amino acid metabolism and a series of major physiological and pathological changes in silkworm. Expand
Cloning and sequencing of proliferating cell nuclear antigen (PCNA) from the flesh fly, Sarcophaga crassipalpis, and its expression in response to cold shock and heat shock.
TLDR
Following acold shock at -10 degrees C for 1 h, expression of ScPCNA decreased in S. crassipalpis whole-body mRNA, suggesting a possible cell-cycle arrest in response to a cold shock. Expand
...
1
2
3
...