HIF2α-Dependent Lipid Storage Promotes Endoplasmic Reticulum Homeostasis in Clear-Cell Renal Cell Carcinoma.

@article{Qiu2015HIF2DependentLS,
  title={HIF2α-Dependent Lipid Storage Promotes Endoplasmic Reticulum Homeostasis in Clear-Cell Renal Cell Carcinoma.},
  author={Bo Qiu and Daniel J Ackerman and Danielle J. Sanchez and Bo Li and Joshua D. Ochocki and Alison Grazioli and Ekaterina Bobrovnikova-Marjon and J Alan Diehl and Brian Keith and M Celeste Simon},
  journal={Cancer discovery},
  year={2015},
  volume={5 6},
  pages={652-67}
}
UNLABELLED Two hallmarks of clear-cell renal cell carcinoma (ccRCC) are constitutive hypoxia-inducible factor (HIF) signaling and abundant intracellular lipid droplets (LD). However, regulation of lipid storage and its role in ccRCC are incompletely understood. Transcriptional profiling of primary ccRCC samples revealed that expression of the LD coat protein gene PLIN2 was elevated in tumors and correlated with HIF2α, but not HIF1α, activation. HIF2α-dependent PLIN2 expression promoted lipid… CONTINUE READING
Highly Cited
This paper has 486 citations. REVIEW CITATIONS
Related Discussions
This paper has been referenced on Twitter 4 times. VIEW TWEETS

Citations

Publications citing this paper.
Showing 1-10 of 25 extracted citations

Hydroxyl-HIF 2-alpha is potential therapeutic target for renal cell carcinomas

GATGCTGGTGTTTGGAGAAATGAC TCCACTGTAATAATAGGCATACCTG, AACTTAACAGCACCTGGAAGTGAC ACCTCTGCCCAAATGACAGGAC, +10 authors GGGAGCCAAAAGGGTCATCATC TGGCATGGACTGTGGTCATGAG
2016
View 12 Excerpts
Highly Influenced

Lipid Droplets: A Key Cellular Organelle Associated with Cancer Cell Survival under Normoxia and Hypoxia

International journal of molecular sciences • 2016
View 5 Excerpts
Highly Influenced

487 Citations

010020030020152016201720182019
Citations per Year
Semantic Scholar estimates that this publication has 487 citations based on the available data.

See our FAQ for additional information.

Similar Papers

Loading similar papers…