Genetic variation and relatedness in grizzly bears in the Prudhoe Bay region and adjacent areas in northern Alaska

@inproceedings{Cronin2005GeneticVA,
  title={Genetic variation and relatedness in grizzly bears in the Prudhoe Bay region and adjacent areas in northern Alaska},
  author={Matthew Anthony Cronin and Richard T. Shideler and Lisette P Waits and Rebecca A Nelson},
  year={2005}
}
Abstract The Prudhoe Bay region of northern Alaska has large oil fields and hunting on adjacent lands, and there are concerns about potential effects on grizzly bears (Ursus arctos) in this region. Because effects on grizzly bear populations may include loss of genetic variation, we assessed the genetic variation and family relationships among grizzly bears in this region as part of a long-term research and monitoring project. We determined genotypes at 14 microsatellite DNA loci for 78 bears… CONTINUE READING
BETA

Citations

Publications citing this paper.
SHOWING 1-8 OF 8 CITATIONS

References

Publications referenced by this paper.
SHOWING 1-10 OF 22 REFERENCES

Trypanotolerance in West African cattle and the population genetic effects of selection

A. EL MOUSADIK, AND O. PONS
  • 2001

Ecological genetic studies of bears using microsatellite analysis

I. STIRLING, AND C. STROBECK
  • Ursus
  • 1998

Gene flow between insular , coastal and interior populations of brown bears in Alaska

XHTGCTTTGGGTTAAATCTAAGCC CCCCAGAGATGTGGCATC, XHATCCAGGTCTGGAATACCCC TCCTTTGAATTAGCACTTGGC, +5 authors XTGGAGGCGTTCTTTCAGTTGGT TGGAACAAAACTTAACACAAATG
  • 1998

Identifying population conservation on the basis of genetic markers

AND K. F. GOODKNIGHT
  • Conservation Biology
  • 1998

Similar Papers

Loading similar papers…