Gene regulation network behind drought escape, avoidance and tolerance strategies in black poplar (Populus nigra L.).

Drought is the major environmental problem limiting the productivity and survival of plant species. Here, previously identified three black poplar genotypes having contrasting response to drought were subjected to gradual soil water depletion in a pot trial to identify their physiological, morphological and antioxidation related adaptations. We also… (More)
  • Presentations referencing similar topics

    • Gene Regulation and Microarrays

      ACGGACTGTTACCACTTCACGCCGACTCAACTGCGCAGAGAAAAACTTCAAACGACAAC A TTGGCATGGCTT TTGTTATTTTTGGCGC TTGACTCAG GAT C T AAAAACTGGAAC G GCGAAGGTGACGGCAATGTTTTGGCAAATAAGCATCCCCGAAGTTCTACAATGCATCTGAGGACTCAATGTTTTTTTTTTTTT TTTTTCTTT AGTCATTCCAAAT GTTTGTTAAATGCATTGTTCCGAAACTTATTTGCCTCTATGAAGGCTGCCCAGTAATTGGGAGCATACTTAACATTGTAGTATTGTA TGTAAATTATGT AACAAAACAATGACTGGGTTTTTGTACTTTCAGCCTTAATCTTGGGTTTTTTTTTTTTTTTGGTTCCAAAAAACTAAGCTTTACCATTCAAGATGTA AAGGTTTCATTCCCCCTGGCATATTGAAAAAGCTGTGTGGAACGTGGCGGTGCAGACATTTGGTGGGGCCA A CCTGTACACTGAC T AATTCAAATAAAA GTGCACATGTAAGACATCCTACTCTGTGTGATTTTTCTGTTTGTGCTGAGTGAACTTGCTATGA GTCTTTTAGTGCACTCTTTAATAAAAGTAGTCTTCCCTTAAAGTGT CCCTTCCCTTATGGCCTTCACATTTCTCAACTAGCGCTTCAACTAGAAAGCACTTTAGGGACTG GGATGC + 2 • Mar 27, 2015

    • Gene Expression & Regulation

      CSEP 590A + 3 • Aug 13, 2017

    • Prokaryotic Gene Regulation Heyer 1 Regulation of Bacterial Gene Expression

      Aug 27, 2017