Fatty acid biosynthesis as a drug target in apicomplexan parasites.

@article{Goodman2007FattyAB,
  title={Fatty acid biosynthesis as a drug target in apicomplexan parasites.},
  author={Christopher Dean Goodman and Geoffrey Ian McFadden},
  journal={Current drug targets},
  year={2007},
  volume={8 1},
  pages={
          15-30
        }
}
Apicomplexan parasitic diseases impose devastating impacts on much of the world's population. The increasing prevalence of drug resistant parasites and the growing number of immuno-compromised individuals are exacerbating the problem to the point that the need for novel, inexpensive drugs is greater now than ever. Discovery of a prokaryotic, Type II fatty acid synthesis (FAS) pathway associated with the plastid-like organelle (apicoplast) of Plasmodium and Toxoplasma has provided a wealth of… Expand
Fatty acid metabolism in the Plasmodium apicoplast: Drugs, doubts and knockouts.
TLDR
How perception of FASII has changed over time is discussed, and key findings about each enzyme in the pathway are presented to identify remaining questions and opportunities for malaria control. Expand
Antimalarial Drugs and Drug Targets Specific to Fatty Acid Metabolic Pathway of Plasmodium falciparum
TLDR
The role of different proteins in fatty acid metabolism is studied and designing, synthesis and evaluation of compounds against the targets identified in fatty acids metabolic pathway is studied. Expand
Drug target identification in intracellular and extracellular protozoan parasites.
TLDR
An overview of strategies for target identification is provided, and examples of selected drug targets are presented, ranging from proteins to nucleic acids to intermediary metabolism. Expand
New approaches for the identification of drug targets in protozoan parasites.
TLDR
In this chapter, the drug targets in protozoan parasites are reviewed and the gene-expression machinery has been among the first targets for antiparasitic drugs and is still under investigation as a target for novel compounds. Expand
Apicoplast and Endoplasmic Reticulum Cooperate in Fatty Acid Biosynthesis in Apicomplexan Parasite Toxoplasma gondii*
TLDR
The apicoplast is a significant source of fatty acids, and its products are further modified in the parasite endoplasmic reticulum, and this elongase pathway appears to have a unique role in generating very long unsaturated fatty acids that cannot be salvaged from the host. Expand
Acquisition of exogenous fatty acids renders apicoplast-based biosynthesis dispensable in tachyzoites of Toxoplasma
TLDR
The results demonstrate that the FAS2 pathway is dispensable during the lytic cycle of Toxoplasma because of its remarkable flexibility in acquiring fatty acids. Expand
Apicoplast acetyl Co-A carboxylase of the human malaria parasite is not targeted by cyclohexanedione herbicides.
TLDR
It is suggested that herbicides that inhibit the plastid acetyl Coenzyme A (Co-A) carboxylase of plants also kill Plasmodium falciparum in vitro, but their mode of action remains undefined, as this pathway is not essential in blood stages of the parasite. Expand
Validation of Putative Apicoplast-Targeting Drugs Using a Chemical Supplementation Assay in Cultured Human Malaria Parasites
ABSTRACT Malaria parasites contain a relict plastid, the apicoplast, which is considered an excellent drug target due to its bacterial-like ancestry. Numerous parasiticidals have been proposed toExpand
Fatty acid synthesis in protozoan parasites: unusual pathways and novel drug targets.
TLDR
Fatty acid biosynthesis pathways in protozoan parasites are reviewed with a view to targeting this metabolism for drug therapy and the state-of-play with known and potential inhibitors is explored. Expand
Computational investigation of the Plasmodium falciparum fatty acid biosynthetic pathway toward the discovery of novel antimalarials
TLDR
The essential role of structural plasticity in key steps of fatty acid biosynthesis in Plasmodium falciparum is investigated by means of molecular simulations and may be perspectively used for the identification of novel pathway-based antimalarial compounds. Expand
...
1
2
3
4
5
...

References

SHOWING 1-10 OF 156 REFERENCES
Chemotherapy
TLDR
To the average practitioner working in Europe and North America, chemotherapy means only aspirin, which is used almost exclusively for its analgesic, antipyretic and chologogic properties. Expand
The plant cell
I n January 1989 the American Society of Plant Physiologists is scheduled to begin publication of a new journal entitled The Plant Cell. Robert B. Goldberg, editor of the new journal, describes theExpand
Parasitology
e tAninlnrius. Linnoeus, from London, and at mens of not tjie saiue About that once found he ^c^gen3 to Mr. Distant, who kindly time I sen were macrocephalus, Fieber. In informec tQ gnlj out whetherExpand
FEBS Lett
The Editorial O¤ce of FEBS Letters has moved from Zu«rich to Heidelberg earlier this year. This O¤ce coordinates distribution and handling of submitted manuscripts, but the actual scienti¢cExpand
Drugs
TLDR
In 20 cases the typical picture of thrombosis of the central vein was present, and in one of these (a woman, aged 47 years) sight was restored in six months, and vision was still 4/5 four years later. Expand
Nature
  • R. Rosenfeld
  • Medicine
  • Otolaryngology--head and neck surgery : official journal of American Academy of Otolaryngology-Head and Neck Surgery
  • 2009
TLDR
I am writing with a simple plea to balance the voluminous articles about treatment in your journal with a modicum of information about nature and caring effects to rekindle the perception of physicians as healers, not only treaters, who relish the gifts of nature, and foster the humanistic aspect of medicine that has thrived for millennia. Expand
Gene
Gene Specie Forward Reverse NPHP1 canine AGCAGGAGGGGAAGAAGT TGGAAGAGTGTGGAAGGC INVS/NPHP2 canine CATGAAGTGATCCAGTTCATGTTG GGCGGCGATGTCCTGTAT NPHP3 canine TCTCTGTGGAGTAACGCTGTCA ATCCCATTGTCTCACACATTCExpand
Biochemistry
The Department of Biochemistry is internationally recognized for its research and education and offers a world-class interdisciplinary research environment in a beautiful mountain setting. As part ofExpand
Fatty Acid Biosynthesis as a Drug Target in Apicomplexan Parasites
  • Biochem. Biophys. Res. Commun.,
  • 2003
Bioorg. Med. Chem. Lett
  • Bioorg. Med. Chem. Lett
  • 2004
...
1
2
3
4
5
...