Endocrine and neurogenic regulation of the orphan nuclear receptors Nur77 and Nurr-1 in the adrenal glands.

@article{Davis1994EndocrineAN,
  title={Endocrine and neurogenic regulation of the orphan nuclear receptors Nur77 and Nurr-1 in the adrenal glands.},
  author={Ian Davis and Lester F. Lau},
  journal={Molecular and cellular biology},
  year={1994},
  volume={14 5},
  pages={3469-83}
}
nurr77 and nurr-1 are growth factor-inducible members of the steroid/thyroid hormone receptor gene superfamily. In order to gain insight into the potential roles of nur77 in the living organism, we used pharmacologic treatments to examine the expression of nur77 in the mouse adrenal gland. We found that nur77 and nurr-1 are induced in the adrenal gland upon treatment with pentylene tetrazole (Ptz; Metrazole). This induction is separable into distinct endocrine and neurogenic mechanisms. In situ… CONTINUE READING

Citations

Publications citing this paper.
Showing 1-10 of 55 extracted citations

A Cell-Autonomous Molecular Cascade Initiated by AMP-Activated Protein Kinase Represses Steroidogenesis

GCACCTCCGCGCCAAGAACT AAGCCCTCCTGCTCGTCGGT, CGTGCTCTTTAACCCAGACCT TCCATGCTGACTGCACCAAT, +6 authors GTTCCTCGCTACGTTCAAGC GAAACACCTTGCCCACATCT
2014
View 3 Excerpts

Similar Papers

Loading similar papers…