Developmental biology: A chordate with a difference

@article{Holland2007DevelopmentalBA,
  title={Developmental biology: A chordate with a difference},
  author={Linda Z Holland},
  journal={Nature},
  year={2007},
  volume={447},
  pages={153-155}
}
  • L. Holland
  • Published 10 May 2007
  • Biology, Medicine
  • Nature
Molecular studies of tunicate development show that genetic programmes for early embryonic patterning can change radically during evolution, without completely disrupting the basic chordate body plan. 
Evolutionary developmental biology and genomics
TLDR
Genomics bridges the gap between evolutionary and developmental biology, and can help answer questions of the evolution of developmental mechanisms, thereby revealing contraction and expansion of the genome and suggesting mechanisms for evolution of both developmental functions and genome architecture. Expand
Chordate roots of the vertebrate nervous system: expanding the molecular toolkit
  • L. Holland
  • Biology, Medicine
  • Nature Reviews Neuroscience
  • 2009
TLDR
Comparisons of developmental gene expression and neuroanatomy between vertebrates and the basal chordate amphioxus indicate that these vertebrate features were built on a foundation already present in the ancestral chordate. Expand
Developmental Constraints on Vertebrate Genome Evolution
TLDR
Genes expressed early in development in zebrafish and mouse have a more dramatic effect of knock-out or mutation and are more likely to revert to single copy after whole genome duplication, relative to genes expressed late, which supports high constraints on early stages of vertebrate development. Expand
Ancestral Vascular Lumen Formation via Basal Cell Surfaces
TLDR
It is discovered that in the invertebrate cephalochordate amphioxus, the basement membranes of endoderm and mesoderm line the lumen of the major vessels, namely aorta and heart, and that basal cell surfaces can form a vascular lumen filled with ECM. Expand
Head organization and the head/trunk relationship in protochordates: problems and prospects.
  • T. Lacalli
  • Biology, Medicine
  • Integrative and comparative biology
  • 2008
TLDR
The morphogenetic growth process that reestablishes symmetry in late-stage larvae can now be seen, at least in part, as a recapitulation of past evolutionary events, and this has important implications for the origin and basic organization of the brain. Expand
Basic features of the ancestral chordate brain: A protochordate perspective
  • T. Lacalli
  • Biology, Medicine
  • Brain Research Bulletin
  • 2008
TLDR
An association between the mouth and the evolving brain reinforces the idea of a fundamental early connection between core brain structures and the control of feeding activity in amphioxus, suggesting a core brain function in ancestral chordates. Expand
Evolution of eukaryotic genome architecture: Insights from the study of a rapidly evolving metazoan, Oikopleura dioica
TLDR
Analysis of the O. dioica genome suggests that non‐adaptive forces such as elevated mutation rates might influence the evolution of genome architecture and may be exploited for synthetic biology applications, such as generation of orthogonal splicing systems. Expand
Lineage-specific loss of FGF17 within the avian orders Galliformes and Passeriformes.
TLDR
FGF17 likely represents a molecular spandrel arising from a genome duplication event and due to its high connectivity with FGF8/FGF18, and potential for interference with their function, is retained under strong purifying selection, despite itself not having a strong selective advantage. Expand
Two Rounds of Whole-Genome Duplication: Evidence and Impact on the Evolution of Vertebrate Innovations
TLDR
The impact of the 2R-WGD may not be related to the immediate origin of vertebrate innovations, but to the subsequent diversification of a wide variety of complex structures that facilitated the successful radiation of vertebrates. Expand
Impact of gene gains, losses and duplication modes on the origin and diversification of vertebrates.
TLDR
It is argued that current evidences points that the 2R-WGD may not be linked to the origin of vertebrate innovations, but to their subsequent diversification in a broad variety of complex structures and functions that facilitated the successful transition from peaceful filter-feeding non-vertebrate ancestors to voracious vertebrate predators. Expand
...
1
2
3
4
5
...

References

SHOWING 1-10 OF 16 REFERENCES
Chordate Evolution and Autonomous Specification of Cell Fate: The Ascidian Embryo Model
TLDR
The present contribution attempts to unite the two themes by postulating that autonomous specification further enhanced the modular nature of the developing tunicate embryo and permitted natural selection to act differentially on the largely independent organ systems of larvae and paedomorphs, in what amounts to a mosaic selection pattern. Expand
Development of a chordate anterior-posterior axis without classical retinoic acid signaling.
TLDR
Results revealed that RA does not cause homeotic posteriorization in Oikopleura as it does in vertebrates and cephalochordates, and showed that a chordate can develop the phylotypic body plan in the absence of the classical morphogenetic role of RA. Expand
Hox cluster disintegration with persistent anteroposterior order of expression in Oikopleura dioica
TLDR
It is shown that the tunicate Oikopleura dioica has a complement of nine Hox genes in which all central genes are lacking but a full vertebrate-like set of posterior genes is present. Expand
Genome evolution and developmental constraint in Caenorhabditis elegans.
TLDR
It was found that the mean rate of amino acid replacement is not significantly different between genes expressed during and after embryogenesis, however, synonymous substitution rates differed significantly between these two classes. Expand
Is retinoic acid genetic machinery a chordate innovation?
TLDR
A new hypothesis is proposed in which lineage‐specific duplication and loss of RA machinery genes could be related to the morphological radiation of deuterostomes, in which this new evolutionary viewpoint argues against the hypothesis that the acquisition of gene families underlying RA metabolism and signaling was a key event for the origin of chordates. Expand
Developmental constraint on gene duplicability in fruit flies and nematodes.
TLDR
It is found that the average duplicability of genes involved in embryonic development is indeed lower than that of genesinvolved in larval development but not significantly lower than those involved in later stages of development. Expand
Deuterostome phylogeny reveals monophyletic chordates and the new phylum Xenoturbellida
TLDR
To study the relationships among all deuterostome groups, an alignment of more than 35,000 homologous amino acids is assembled, including new data from a hemichordate, starfish and Xenoturbella and it is concluded that chordates are monophyletic. Expand
Urochordates are monophyletic within the deuterostomes.
TLDR
A detailed phylogenetic analysis of urochordates based on comparisons of 10 new u rochordate 18S ribosomal DNA sequences with other uroChordate sequences in GenBank suggests strongly that uro chordates form a monophyletic clade within the deuterostomes. Expand
Gene
Gene Specie Forward Reverse NPHP1 canine AGCAGGAGGGGAAGAAGT TGGAAGAGTGTGGAAGGC INVS/NPHP2 canine CATGAAGTGATCCAGTTCATGTTG GGCGGCGATGTCCTGTAT NPHP3 canine TCTCTGTGGAGTAACGCTGTCA ATCCCATTGTCTCACACATTCExpand
Nature
  • R. Rosenfeld
  • Medicine
  • Otolaryngology--head and neck surgery : official journal of American Academy of Otolaryngology-Head and Neck Surgery
  • 2009
TLDR
I am writing with a simple plea to balance the voluminous articles about treatment in your journal with a modicum of information about nature and caring effects to rekindle the perception of physicians as healers, not only treaters, who relish the gifts of nature, and foster the humanistic aspect of medicine that has thrived for millennia. Expand
...
1
2
...