Development of primers specific for LMW-GS genes located on chromosome 1D and molecular characterization of a gene from Glu-D3 complex locus in bread wheat.

@article{Zhao2004DevelopmentOP,
  title={Development of primers specific for LMW-GS genes located on chromosome 1D and molecular characterization of a gene from Glu-D3 complex locus in bread wheat.},
  author={Huixian Zhao and Ruijuan Wang and Aiguang Guo and Shengwu Hu and Genlou Sun},
  journal={Hereditas},
  year={2004},
  volume={141 3},
  pages={193-8}
}
Glutenins are multimeric aggregates of high molecular weight (HMW) and low molecular weight (LMW) subunits, which determine the quality in wheat. Development of locus-specific primers is an important step toward cloning specific LMW glutenin subunits (LMW-GS) by PCR method. Based on the publicly available, a pair of primer, namely primer 3 (5' TTGTAGAAACTGCCATCCTT 3') and primer 4 (5' GTCACCGCTGCAT CGACATA 3') was designed and verified to specific for LMW-GS genes located on chromosome 1D in… CONTINUE READING
Highly Cited
This paper has 20 citations. REVIEW CITATIONS