DNA structure: what's in charge?

@article{McConnell2000DNASW,
  title={DNA structure: what's in charge?},
  author={Kevin J. McConnell and David L. Beveridge},
  journal={Journal of molecular biology},
  year={2000},
  volume={304 5},
  pages={803-20}
}
DNA structure is well known to be sensitive to hydration and ionic strength. Recent theoretical predictions and experimental observations have raised the idea of the intrusion of monovalent cations into the minor groove spine of hydration in B-form DNA. To investigate this further, extensions and further analysis of molecular dynamics (MD) simulations on d(CGCCGAATTCGCG), d(ATAGGCAAAAAATAGGCAAAAATGG) and d(G(5)-(GA(4)T(4)C)(2)-C(5)), including counterions and water, have been performed. To… CONTINUE READING

Citations

Publications citing this paper.
Showing 1-10 of 35 extracted citations

DNA and its counterions: a molecular dynamics study.

Nucleic acids research • 2004
View 6 Excerpts
Highly Influenced

DNA and lipid bilayers: self-assembly and insertion.

Journal of the Royal Society, Interface • 2008
View 1 Excerpt
Highly Influenced

Similar Papers

Loading similar papers…