Corrigendum to 'Development of a duplex one-step RT-qPCR assay for the simultaneous detection of Apple scar skin viroidand plant RNA internal control' [J. Virol. Methods (2015) 100-105].

Abstract

ASSVd-119F SAAAGGAGCTGCCAGCA 450nM This study ASSVd-198F GGTGTTGAGGCCCTG 450nM This study ASSVd-221P FAM-CTGCGCTGCCACCTACTCT-BHQ1 150nM This study ASSVd-237P FAM-AGAGTAGGTGGCAGCGCAGC-BHQ1 150nM This study ASSVd-P2 FAM-TGTTGAGGCCCTGYCYG-BHQplus 150nM This study ASSVd-263R GGAGTCCGCTCGACT 500nM This study NAD5-TM-F GCTTCTTGGGGCTTCTTGTT 150nM Mackay… (More)
DOI: 10.1016/j.jviromet.2016.07.027

Cite this paper

@article{Khan2016CorrigendumT, title={Corrigendum to 'Development of a duplex one-step RT-qPCR assay for the simultaneous detection of Apple scar skin viroidand plant RNA internal control' [J. Virol. Methods (2015) 100-105].}, author={Subuhi Khan and John F Mackay and Lia Liefting and Lisa Ward}, journal={Journal of virological methods}, year={2016}, volume={235}, pages={196} }