Construction, detection and microarray analysis on theShigella flexneri 2asitC mutant

In order to overcome the defects of difficult gene operations in low-copy suicide plasmid pCVD442, Gateway technology was applied in the construction process of recombinant plasmid for gene knockout in this study. With this improved knockout system, we inactivatedsitC gene, which is associated with iron transport inShigella flexneri 2a strain 301, to yield… CONTINUE READING
  • Presentations referencing similar topics

    • Gene Regulation and Microarrays

      ACGGACTGTTACCACTTCACGCCGACTCAACTGCGCAGAGAAAAACTTCAAACGACAAC A TTGGCATGGCTT TTGTTATTTTTGGCGC TTGACTCAG GAT C T AAAAACTGGAAC G GCGAAGGTGACGGCAATGTTTTGGCAAATAAGCATCCCCGAAGTTCTACAATGCATCTGAGGACTCAATGTTTTTTTTTTTTT TTTTTCTTT AGTCATTCCAAAT GTTTGTTAAATGCATTGTTCCGAAACTTATTTGCCTCTATGAAGGCTGCCCAGTAATTGGGAGCATACTTAACATTGTAGTATTGTA TGTAAATTATGT AACAAAACAATGACTGGGTTTTTGTACTTTCAGCCTTAATCTTGGGTTTTTTTTTTTTTTTGGTTCCAAAAAACTAAGCTTTACCATTCAAGATGTA AAGGTTTCATTCCCCCTGGCATATTGAAAAAGCTGTGTGGAACGTGGCGGTGCAGACATTTGGTGGGGCCA A CCTGTACACTGAC T AATTCAAATAAAA GTGCACATGTAAGACATCCTACTCTGTGTGATTTTTCTGTTTGTGCTGAGTGAACTTGCTATGA GTCTTTTAGTGCACTCTTTAATAAAAGTAGTCTTCCCTTAAAGTGT CCCTTCCCTTATGGCCTTCACATTTCTCAACTAGCGCTTCAACTAGAAAGCACTTTAGGGACTG GGATGC + 2 • Mar 27, 2015

    • Gene expression : Microarray data analysis

      Jul 14, 2015

    • The microarray data ( wild type )

      Torsten Hain + 1 • Jun 30, 2017