Complexity at the mouse minor histocompatibility locusH-4

@article{Davis1990ComplexityAT,
  title={Complexity at the mouse minor histocompatibility locusH-4},
  author={Allan Peter Davis and Derry Charles Roopenian},
  journal={Immunogenetics},
  year={1990},
  volume={31},
  pages={7-12}
}
The fine immunogenetics of the chromosome 7 mouse minor histocompatibility (H) locusH-4 was investigated. Both class I major histocompatibility complex (MHC)-restricted cytotoxic T lymphocytes (CTL) and class II MHC-restricted “helper” T cells (TH) specifically reactive with H-4 antigens were isolated as clones and were used as genetic probes for classical backcross segregation analysis. Results of a four point cross indicated that theH-4 locus was actually comprised of two genes, that have… CONTINUE READING
13 Citations
27 References
Similar Papers

Citations

Publications citing this paper.
Showing 1-10 of 13 extracted citations

Second Class Minors : Molecular Identification of the Autosomal H 46 Histocompatibility Locus as a Peptide Presented by Major Histocompatibility Complex Class II Molecules

  • CCGGAATTCCATCACGTGTTCGTGGAGACT TGTAAAACGACGGCCAGTGC, CCGGAATTCCATTCGCAAAGAGGAAGTGAG TGTAAAACGACGGCCAGTGC, GGTGACGCTCTTAAAAATTAAGCC GACTCTAGACGTTTCCACCAACAAGTG, GGTGACGCTCTTAAAAATTAAGCC GACTCTAGATTGCGATTAGGAGTGGTC, CCGGAATTCCATGTCAGCCCAGATGAACAG GACTCTAGATTGCGATTAGGAGTGGTC, GAGGGGCAGCAACACATGTTTGTGGAGGCCA TGGCCTCCACAAACATGTGTTGCTGCCCCTC
  • 2003
Highly Influenced
6 Excerpts

References

Publications referenced by this paper.
Showing 1-10 of 27 references

Tumor - induced immunity to HY - disparate skin grafts without concomintant priming of CTL

  • L. L. Johnson, D. L. Hines
  • 1989

Generation of helper cell-independent cytotoxic T cells is dependent upon L3T4-positive helper T cells

  • D. C. Roopellian, P. S. Anderson
  • J Immunol
  • 1988

T - cell recognition of lysozyme : the biochemical basis of presentation

  • P. M. Allen, B. P. Babbit, E. R. Unanue
  • Immunol Rev
  • 1987

Similar Papers

Loading similar papers…