Characterization of a subcloned fragment (pBA0.6) of pCMM86 located on 17q21 and its potential use in generating an individual-specific DNA profile.

Abstract

Sequence analysis was carried out of a human clone pBA0.6 generated after exonuclease III/S1 nuclease digestion and subcloning of pCMM86 (GDB: 168382, D17S74), which was not available in the database. It revealed the presence of a reiterating core motif of 24mer GTGGGTGTGTTGGAGGGGGTGAGG, present 23 times, which was GC-rich and minisatellitic in nature… (More)

Topics

Cite this paper

@article{Saha2000CharacterizationOA, title={Characterization of a subcloned fragment (pBA0.6) of pCMM86 located on 17q21 and its potential use in generating an individual-specific DNA profile.}, author={A. Saha and S Hamid Husain and Rameshwar N. K. Bamezai}, journal={DNA and cell biology}, year={2000}, volume={19 4}, pages={219-26} }