• Corpus ID: 35845921

CCGTCGCTCCTGGATCTGTCAA HelR GCCGCAGTGAACTGTATTAGAGGTGGGAT HelF ATCCCACCTCTAATACAGTTCACTGCGGC PolR ACGAGAAATTAGACGCCAAACAATGAATG PolF CCACGCTGAAGCGATCTGTATCGAAAC HSPR ACCACGAAAGTGCTGTTTCTAACAGAGAC HSPF AGAAACAGCACTTTCGTGGTTAAAGCGTC CPR GACATCAGTTGCGTTTTCCACCTCCG CPF AGCTCGGAGGTGGAAAACGCAACTGA

@inproceedings{Tzanetakis2005CCGTCGCTCCTGGATCTGTCAAHG,
  title={CCGTCGCTCCTGGATCTGTCAA HelR GCCGCAGTGAACTGTATTAGAGGTGGGAT HelF ATCCCACCTCTAATACAGTTCACTGCGGC PolR ACGAGAAATTAGACGCCAAACAATGAATG PolF CCACGCTGAAGCGATCTGTATCGAAAC HSPR ACCACGAAAGTGCTGTTTCTAACAGAGAC HSPF AGAAACAGCACTTTCGTGGTTAAAGCGTC CPR GACATCAGTTGCGTTTTCCACCTCCG CPF AGCTCGGAGGTGGAAAACGCAACTGA},
  author={Ioannis E. Tzanetakis and Joseph D. Postman and Robert R Martin},
  year={2005}
}
Tzanetakis, I. E., Postman, J. D., and Martin, R. R. 2005. Characterization of a novel member of the family Closteroviridae from Mentha spp. Phytopathology 95:1043-1048. While characterizing the agents involved in symptomatology of a variegated mint, Mentha × gracilis ‘Variegata’, a nursery plant with atypical symptoms was examined. This plant, unlike ‘Variegata’, did not exhibit yellow vein banding symptoms but instead had distorted and crinkled leaves. Molecular tests for the three viruses… 

Figures and Tables from this paper

References

SHOWING 1-10 OF 56 REFERENCES
Functional Specialization and Evolution of Leader Proteinases in the Family Closteroviridae
TLDR
Results demonstrated that, in addition to a common proteolytic activity, the leader proteinases of closteroviruses possess specialized functions in virus RNA amplification, virus invasion, and cell-to-cell movement.
Evidence of multiple recombination events between two RNA sequence variants within a Citrus tristeza virus isolate.
TLDR
Analysis of sequence variants of a natural Citrus tristeza virus (CTV) isolate (SY568) revealed that its population was composed of three sequence types, one of which was suggested as a hot-spot for homologous recombination in other RNA viruses.
Ultrastructural localization and epitope mapping of the methyltransferase-like and helicase-like proteins of Beet yellows virus.
TLDR
Monoclonal antibodies specific to the methyltransferase (MT) and helicase (HEL) domains of the closterovirus Beet yellows virus (BYV) were used for immunogold labelling of ultrathin sections of virus-infected Tetragonia expansa plants, suggesting that the clesterovirus MT-like and HEL-like proteins co-localize in these structures.
First Report of Strawberry latent ringspot virus in a Mentha sp. from North America.
TLDR
To the authors' knowledge, this is the first report of SLRSV in mint in North America and primers F and R were developed and used in reverse transcription-polymerase chain reaction (RT-PCR) to amplify a 497-bp fragment of RNA 2 ofSLRSV from MEN-454.
Leader Proteinase of Beet Yellows Virus Functions in Long-Distance Transport
TLDR
Alanine-scanning mutagenesis was applied to complete the functional analysis of L-Pro and concluded that in addition to previously identified functions, it also serves as the BYV long-distance transport factor.
A Member of the Closteroviridae from Mint with Similarities to All Three Genera of the Family.
TLDR
A detection protocol has been developed that readily detects the virus in other mint clones that exhibit vein-banding symptoms, making it an important link among the genera of the Closteroviridae.
Genetic Variation of Citrus Tristeza VirusIsolates from California and Spain: Evidence for Mixed Infections and Recombination
TLDR
Examination of the population structure and genetic variation of four genomic regions within and between 30 Citrus tristeza virus isolates from Spain and California suggested that the genomes of some CTV sequence variants originated by recombination events between diverged sequence variants.
The family Closteroviridae revised
TLDR
The mealybug-transmitted species have been separated from the genus Closterovirus and accommodated in a new genus named Ampelovirus (from ampelos, Greek for grapevine), and the family now comprises three genera.
Complete sequence of the citrus tristeza virus RNA genome.
TLDR
Phylogenetic analysis of the three replication-associated domains, MT, HEL, and RdRp, indicates that CTV and BYV form a separate closterovirus lineage within the alpha-like supergroup of positive-strand RNA viruses.
Identification and Detection of a Virus Associated with Strawberry Pallidosis Disease.
TLDR
Alignments of the major coat protein show that the virus isolated from strawberry plants positive for pallidosis is most closely related to Cucumber yellows virus and Cucurbit yellow stunt disorder virus, members of the Crinivirus genus.
...
1
2
3
4
5
...