Analysis of temporal gene expression during Bacillus subtilis spore germination and outgrowth.

@article{Keijser2007AnalysisOT,
  title={Analysis of temporal gene expression during Bacillus subtilis spore germination and outgrowth.},
  author={B. Keijser and A. Ter Beek and H. Rauwerda and F. Schuren and R. Montijn and H. van der Spek and S. Brul},
  journal={Journal of bacteriology},
  year={2007},
  volume={189 9},
  pages={
          3624-34
        }
}
Bacillus subtilis forms dormant spores upon nutrient depletion. Under favorable environmental conditions, the spore breaks its dormancy and resumes growth in a process called spore germination and outgrowth. To elucidate the physiological processes that occur during the transition of the dormant spore to an actively growing vegetative cell, we studied this process in a time-dependent manner by a combination of microscopy, analysis of extracellular metabolites, and a genome-wide analysis of… Expand
126 Citations
RNA Dynamics in Aging Bacterial Spores
  • 80
Integrative analysis of proteome and transcriptome dynamics during Bacillus subtilis spore revival
  • 6
  • PDF
Analysis of Bacillus subtilis spore germination andoutgrowth in high-salinity environments
  • Highly Influenced
  • PDF
Evidence of defined temporal expression patterns that lead a gram-negative cell out of dormancy
  • 1
  • Highly Influenced
  • PDF
Identification of Differentially Expressed Genes during Bacillus subtilis Spore Outgrowth in High-Salinity Environments Using RNA Sequencing
  • 30
  • Highly Influenced
  • PDF
Transcriptional Analysis of Temporal Gene Expression in Germinating Clostridium difficile 630 Endospores
  • 50
  • Highly Influenced
  • PDF
Array-based transcriptional analysis of Clostridium sporogenes UC9000 during germination, cell outgrowth and vegetative life.
  • 18
  • Highly Influenced
...
1
2
3
4
5
...

References

SHOWING 1-10 OF 82 REFERENCES
Spore germination.
  • P. Setlow
  • Medicine
  • Current opinion in microbiology
  • 2003
  • 273
[Molecular biology of the germination of Bacillus spores].
  • M. Hecker
  • Biology, Medicine
  • Zeitschrift fur allgemeine Mikrobiologie
  • 1983
  • 7
Transcriptional responses during outgrowth of Bacillus subtilis endospores.
  • 23
[Activation of protein biosynthesis in outgrowing spores of Bacillus subtilis].
  • 12
Biochemical studies of bacterial sporulation and germination. 23. Nucleotide metabolism during spore germination.
  • 50
Transcriptional responses during outgrowth of Bacillus subtilis endospores
  • GTACTTCTCCAGCTTGCGTT, SigM, TCGATGAAATTTACCAATGTAC
  • 11
Analysis of nucleoid morphology during germination and outgrowth of spores of Bacillus species.
  • 50
  • PDF
Biochemical studies of bacterial sporulation and germination. XXII. Energy metabolism in early stages of germination of Bacillus megaterium spores.
  • 112
...
1
2
3
4
5
...