• DOI:10.1101/062489
Corpus ID: 16962961

Allelic spectrum of the RNA guided CRISPR/Cas9 DNA repair events at PAM associated trinucleotide repeat (NGG)n in Caenorhabditis elegans.

@article{Kapulkin2016AllelicSO,
  title={Allelic spectrum of the RNA guided CRISPR/Cas9 DNA repair events at PAM associated trinucleotide repeat (NGG)n in Caenorhabditis elegans.},
  author={W. Kapulkin},
  journal={bioRxiv},
  year={2016}
}

W. Kapulkin

Published 2016

Biology

bioRxiv

This work describes the experience with implementation of Streptococcus pyogenes Cas9 nuclease, expressed in C. elegans germline. The described work utilizes guide RNA-unc-22-1000 (GGAGAAGGAGGCGGTGCTGG) designed to target the polyglycine encoding stretch within the unc-22gene embedding the impure trinucleotide (NGG)n PAM repeat region. We describe the allelic spectrum of mutational events identified at position specified by gRNA-unc-22-1000. Of above experiments we conclude: i. the… CONTINUE READING

View via Publisher

biorxiv.org

Save to Library

Create Alert

Cite

Launch Research Feed