Allelic spectrum of the RNA guided CRISPR/Cas9 DNA repair events at PAM associated trinucleotide repeat (NGG)n in Caenorhabditis elegans.

@article{Kapulkin2016AllelicSO,
  title={Allelic spectrum of the RNA guided CRISPR/Cas9 DNA repair events at PAM associated trinucleotide repeat (NGG)n in Caenorhabditis elegans.},
  author={W. Kapulkin},
  journal={bioRxiv},
  year={2016}
}
  • W. Kapulkin
  • Published 2016
  • Biology
  • bioRxiv
  • This work describes the experience with implementation of Streptococcus pyogenes Cas9 nuclease, expressed in C. elegans germline. The described work utilizes guide RNA-unc-22-1000 (GGAGAAGGAGGCGGTGCTGG) designed to target the polyglycine encoding stretch within the unc-22gene embedding the impure trinucleotide (NGG)n PAM repeat region. We describe the allelic spectrum of mutational events identified at position specified by gRNA-unc-22-1000. Of above experiments we conclude: i. the… CONTINUE READING
    1 Citations

    References

    SHOWING 1-10 OF 51 REFERENCES
    Microhomology-based choice of Cas9 nuclease target sites
    • 247
    • PDF
    A Programmable Dual-RNA–Guided DNA Endonuclease in Adaptive Bacterial Immunity
    • 8,011
    • PDF
    Microhomology-mediated end-joining-dependent integration of donor DNA in cells and animals using TALENs and CRISPR/Cas9
    • 287
    • PDF
    Engineering the Caenorhabditis elegans Genome Using Cas9-Triggered Homologous Recombination
    • 663
    • Highly Influential
    • PDF
    Precise in-frame integration of exogenous DNA mediated by CRISPR/Cas9 system in zebrafish
    • 178
    • PDF
    A Co-CRISPR Strategy for Efficient Genome Editing in Caenorhabditis elegans
    • 212
    • PDF