Abundance, genetic diversity and conservation of Louisiana black bears (Ursus americanus luteolus) as detected through noninvasive sampling

@article{Triant2004AbundanceGD,
  title={Abundance, genetic diversity and conservation of Louisiana black bears (Ursus americanus luteolus) as detected through noninvasive sampling},
  author={Deborah A. Triant and Richard M. Pace and Michael Stine},
  journal={Conservation Genetics},
  year={2004},
  volume={5},
  pages={647-659}
}
Although the Louisiana black bear (Ursus americanus luteolus) is currently listed as threatened under the Endangered Species Act, there have been no attempts to estimate range-wide abundance. This subspecies was thought to occupy a near contiguous range across southern Mississippi, Louisiana and east Texas but is now restricted to three isolated areas in Louisiana. In 1964, Louisiana initiated a restocking program in which black bears from Minnesota were introduced into two of these areas. It… CONTINUE READING

References

Publications referenced by this paper.
Showing 1-10 of 79 references

Reliable genotyping of samples with very low DNA quantities using PCR.

Nucleic acids research • 1996
View 15 Excerpts
Highly Influenced

Genetic tagging of free-ranging black and brown bears

JG Woods, D Paetkau, +3 authors C Strobeck
Wildl. Soc. Bull., • 1999
View 4 Excerpts
Highly Influenced

Gene flow between insular , coastal and interior populations of brown bears in Alaska

XHTGCTTTGGGTTAAATCTAAGCC CCCCAGAGATGTGGCATC, XHATCCAGGTCTGGAATACCCC TCCTTTGAATTAGCACTTGGC, +5 authors XTGGAGGCGTTCTTTCAGTTGGT TGGAACAAAACTTAACACAAATG
1998
View 4 Excerpts
Highly Influenced

Technical considerations for hair genotyping methods in black bears

CM Clarke, D Immell, SK Wasser
West. Workshop Black Bear Res. Manage., • 2001
View 2 Excerpts
Highly Influenced

GENEPOP (version 1.2): Population genetics software for exact tests and ecumenicism

M Raymond, F Rousset
J. Heredity, • 1995
View 1 Excerpt
Highly Influenced

Movement Patterns of Black Bears in South Central Louisiana

RO Wagner
MS Thesis, • 1995
View 2 Excerpts
Highly Influenced

Status of the Louisiana black bear. Office of Endangered Species, US Fish and Wildlife

RM Nowak
1986
View 3 Excerpts
Highly Influenced

Similar Papers

Loading similar papers…