A new biological agent for treatment of Shiga toxigenic Escherichia coli infections and dysentery in humans

@article{Paton2000ANB,
  title={A new biological agent for treatment of Shiga toxigenic Escherichia coli infections and dysentery in humans},
  author={Adrienne W Paton and Renato Morona and James C Paton},
  journal={Nature Medicine},
  year={2000},
  volume={6},
  pages={265-270}
}
Gastrointestinal disease caused by Shiga toxin-producing bacteria (such as Escherichia coli O157:H7 and Shigella dysenteriae) is often complicated by life-threatening toxin-induced systemic sequelae, including hemolytic–uremic syndrome. Such infections can now be diagnosed very early in the course of the disease, but at present no effective therapeutic intervention is possible. Here, we constructed a recombinant bacterium that displayed a Shiga toxin receptor mimic on its surface, and it… CONTINUE READING

From This Paper

Figures, tables, and topics from this paper.

Citations

Publications citing this paper.
Showing 1-10 of 66 extracted citations

Bacterial Glycoengineering as a Biosynthetic Route to Customized Glycomolecules.

Advances in biochemical engineering/biotechnology • 2018
View 4 Excerpts
Highly Influenced

Recent Progress of Shiga Toxin Neutralizer for Treatment of Infections by Shiga Toxin-Producing Escherichia coli

Archivum Immunologiae et Therapiae Experimentalis • 2011
View 3 Excerpts
Highly Influenced

A New Family of Potent AB 5 Cytotoxins Produced by Shiga Toxigenic Escherichia coli

GTACGGACTAACAGGGAACTG, ATCGTCATATGCACCTCCG, +5 authors TGTCACTTTATCTACAAGTGAAGGGTATTTATCTGCAGACCATATGAATA
2004
View 3 Excerpts
Highly Influenced

References

Publications referenced by this paper.
Showing 1-10 of 40 references

Structural analysis of the lipopolysaccharide oligosaccharide epitopes expressed by a capsule deficient strain of Haemophilus influenzae

A Risberg
Rd. Eur. J. Biochem • 1999

Structural analysis of the lipopolysaccharide oligosaccharide epitopes expressed by a capsule deficient strain of Haemophilus influenzae Rd

A. Risberg
Eur . J . Biochem . • 1999

The structures of the carbohydrate backbones of the lipopolysaccharides from Escherichia coli rough mutants F470 (R1 core type) and F576 (R2 coretype)

Vinogradov, E.V
Eur. J. Biochem. 261, • 1999

protein immunogens, live delivery systems and nucleic acid vaccines

S. Liljeqvist, Stahl, S. Production of recombinant subunit vaccines
J. Biotech. 73, 1–33 • 1999

Diarrheagenic Escherichia coli.

Clinical microbiology reviews • 1998

Similar Papers

Loading similar papers…