A mutation in the Bordetella bronchiseptica bvgS gene results in reduced virulence and increased resistance to starvation, and identifies a new class of Bvg-regulated antigens.

@article{Cotter1997AMI,
  title={A mutation in the Bordetella bronchiseptica bvgS gene results in reduced virulence and increased resistance to starvation, and identifies a new class of Bvg-regulated antigens.},
  author={Peggy Cotter and Jeff Miller},
  journal={Molecular microbiology},
  year={1997},
  volume={24 4},
  pages={671-85}
}
The Bordetella BvgAS signal-transduction system has traditionally been viewed as mediating a transition between two distinct phenotypic phases: the Bvg+ phase, characterized by the expression of adhesins and toxins, and the Bvg-phase, characterized by motility in Bordetella bronchiseptica and by the expression of vrg loci in Bordetella pertussis. In B. bronchiseptica, the Bvg+ phase is necessary and sufficient for respiratory tract colonization whereas the Bvg phase is required for growth under… CONTINUE READING

Citations

Publications citing this paper.
Showing 1-10 of 67 extracted citations

An Improved Recombination-Based In Vivo Expression Technology-Like Reporter System Reveals Differential cyaA Gene Activation in Bordetella Species

AAATCCGCCGCTAGGAGCTT GFLseq, GTCTGCCATGATGTATACATTGTGTG GFLseq, +9 authors AAACAAACCACCGCTGGTAGC GFLseq
2013
View 5 Excerpts
Highly Influenced

PAS domains: internal sensors of oxygen, redox potential, and light.

Microbiology and molecular biology reviews : MMBR • 1999
View 13 Excerpts
Highly Influenced

Similar Papers

Loading similar papers…