A haplotype-based molecular analysis of CFTR mutations associated with respiratory and pancreatic diseases.

@article{Lee2003AHM,
  title={A haplotype-based molecular analysis of CFTR mutations associated with respiratory and pancreatic diseases.},
  author={Ji Hyun Lee and Ji Ha Choi and Wan Namkung and John W. Hanrahan and Joon Chang and Si Young Song and Seung Woo Park and Dong Soo Kim and J. P. Yoon and Yousin Suh and I. J. Jang and Joo Hyun Nam and Sung Joon Kim and Mi-Ook Cho and Jong-Eun Lee and Kyung Hwan Kim and Min Goo Lee},
  journal={Human molecular genetics},
  year={2003},
  volume={12 18},
  pages={2321-32}
}
Aberrant membrane transport caused by mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene is associated with a wide spectrum of respiratory and digestive diseases as well as cystic fibrosis. Using a gene scanning method, we found 11 polymorphisms and mutations of the CFTR gene in the Korean population. Individual variants at these sites were analyzed by conventional DNA screening in 117 control and 75 patients having bronchiectasis or chronic pancreatitis. In a… CONTINUE READING

Citations

Publications citing this paper.
Showing 1-10 of 46 extracted citations

Functional characteristics of L 1156 F-CFTR associated with alcoholic chronic pancreatitis in Japanese

ACACTTAGATTCAAGTAATACT, CAGAAGCTAAGAACTATATGA, +21 authors TCCACTGGGCAATTATTTCAT
2015
View 5 Excerpts
Highly Influenced

Functional characteristics of L1156F-CFTR associated with alcoholic chronic pancreatitis in Japanese.

American journal of physiology. Gastrointestinal and liver physiology • 2015
View 5 Excerpts
Highly Influenced

Novel CFTR Mutations in a Korean Infant with Cystic Fibrosis and Pancreatic Insufficiency

Journal of Korean medical science • 2010
View 4 Excerpts
Highly Influenced

Similar Papers

Loading similar papers…