A New Class of Transcription Factors Mediates Brassinosteroid-Regulated Gene Expression in Arabidopsis

@article{Yin2005ANC,
  title={A New Class of Transcription Factors Mediates Brassinosteroid-Regulated Gene Expression in Arabidopsis},
  author={Yanhai Yin and Dionne Vafeados and Yi Tao and Shigeo Yoshida and Tadao Asami and Joanne Chory},
  journal={Cell},
  year={2005},
  volume={120},
  pages={249-259}
}
Brassinosteroids (BRs) signal through a plasma membrane-localized receptor kinase to regulate plant growth and development. We showed previously that a novel protein, BES1, accumulates in the nucleus in response to BRs, where it plays a role in BR-regulated gene expression; however, the mechanism by which BES1 regulates gene expression is unknown. In this study, we dissect BES1 subdomains and establish that BES1 is a transcription factor that binds to and activates BR target gene promoters both… CONTINUE READING

Citations

Publications citing this paper.
SHOWING 1-10 OF 232 CITATIONS, ESTIMATED 80% COVERAGE

phyB Interacts with BES1 to Regulate Brassinosteroid Signaling in Arabidopsis

  • Plant & cell physiology
  • 2019
VIEW 9 EXCERPTS
CITES BACKGROUND & METHODS
HIGHLY INFLUENCED

The bHLH proteins BEE and BIM positively modulate the shade avoidance syndrome in Arabidopsis seedlings.

  • The Plant journal : for cell and molecular biology
  • 2013
VIEW 13 EXCERPTS
CITES BACKGROUND
HIGHLY INFLUENCED

FILTER CITATIONS BY YEAR

2005
2019

CITATION STATISTICS

  • 46 Highly Influenced Citations

  • Averaged 19 Citations per year from 2017 through 2019

References

Publications referenced by this paper.
SHOWING 1-10 OF 50 REFERENCES

ATP using T4 nucleotide kinase

D. Coll-Garcia, J. Mazuch, T. Altmann, C. Mussig
  • FEBS Lett. KOH [pH 8.0],
  • 2004
VIEW 2 EXCERPTS

Comprehensive comparison of auxin - regulated and bras - AC - like ( TGGCAAGTCTCTGCAACATC ; TTGGAGCACCTAAACCA sinosteroid regulated genes in Arabidopsis

Z. He, Z. Y. Wang, +4 authors J. Chory
  • Plant Physiol .
  • 2004

plasmids into plant tissues

Y. Yin, C. Yu, D. Vafeados, S. Mora-Garcı́a, tions
  • Development
  • 2004

reactions were carried out in 20  l binding buffer ( 25 mM HEPES - EXORDIUM regulates brassinosteroid - responsive genes

C. A. Joazeiro, J. Li, T. Hunter
  • FEBS Lett . KOH
  • 2004