δβ-Thalassemia trait: how can we discriminate it from β-thalassemia trait and iron deficiency anemia?

@article{VelascoRodrguez2014ThalassemiaTH,
  title={$\delta$$\beta$-Thalassemia trait: how can we discriminate it from $\beta$-thalassemia trait and iron deficiency anemia?},
  author={Diego Velasco-Rodr{\'i}guez and Juan Manuel Alonso-Dom{\'i}nguez and Fernando-Ata{\'u}lfo Gonz{\'a}lez-Fern{\'a}ndez and J. Esteban Villarrubia and Paloma Ropero and Jorge Mart{\'i}nez-Nieto and F{\'e}lix de la Fuente and Raquel Guill{\'e}n and Natalia Acedo and Cristina Ser{\'i} and Fernando Cava},
  journal={American journal of clinical pathology},
  year={2014},
  volume={142 4},
  pages={
          567-73
        }
}
OBJECTIVES To analyze the differences not only in classic hematologic parameters but also in RBC subpopulations among δβ-thalassemia trait (δβ-TT), β-thalassemia trait (β-TT), and iron deficiency anemia (IDA) and to evaluate the role of fetal hemoglobin (HbF) in elevated RBC distribution width (RDW). METHODS Samples from 553 patients with microcytosis (74 δβ-TT, 272 β-TT, and 207 IDA) were run on an Advia 2120i analyzer (Siemens Medical Solutions Diagnostics, Tarrytown, NY). Classic… 
View on PubMed
academic.oup.com
7 Citations
Background Citations
1

7 Citations

Citation Type

Citation Type

Hb Knossos (HBB: c.82G > T), β-globin CD 5 (−CT) (HBB: c.17_18delCT) and δ-globin CD 59 (−a) (HBD: c.179delA) mutations in a Syrian patient with β-thalassemia intermedia
TLDR
This is the first report of beta thalassemia intermedia due to combination of Hb Knossos /codon 5 [−CT] associated with δ0 codon 59 [−A] in Syrian patient.
Reticulocyte parameters of delta beta thalassaemia trait, beta thalassaemia trait and iron deficiency anaemia
TLDR
The degree of anisocytosis in reticulocytes from patients with thalassaemia is correlated with HbF, suggesting a certain degree of inefficient erythropoiesis in IDA in comparison with β-TT.
Clinical relevance of erythrocyte ferritin in microcytic anemias.
High Performance Liquid Chromatography (HPLC) Screening among Filipinos with Suspected Thalassemia
TLDR
Results of this study provide the spectrum and frequency of thalassemias and hemoglobinopathies in patients referred to the laboratory for HPLC analysis.
Determinant factors of depression in beta major thalassemia children
TLDR
Mild depression is more common in thalassemia patients who experience complications and had high serum cortisol levels, while complication and serum cortisol level had significant value as determinant factors of depression in Beta Major Thalassemi children.
Three novel HBB mutations, c.‐140C>G (‐90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 ‐20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β‐Thalassemia in Mexican mestizo patients
TLDR
Beta‐thalassemia (β‐thal) is frequent in Mexican patients with microcytosis and hypochromia and three novel mutations are reported and the actual mutational spectrum in Mexican population is analyzed.
Formulas for the Detection β-Thalassemia Carriers Are Affected by Changes in Red Cell Parameters
  • D. Aslan
  • Business
    Mediterranean journal of hematology and infectious diseases
  • 2018

References

SHOWING 1-10 OF 32 REFERENCES
Erythrocyte and reticulocyte parameters in iron deficiency and thalassemia
TLDR
ErythrocyTosis and severe microcytosis, together with a high percentage of microcytes and a moderate increase in IRF, is the profile of β‐thalassemia carriers, whereas anisocytosis and the hypochromic subset correlates with the severity of the anemia in iron‐deficient patients.
Automated measurement of red blood cell microcytosis and hypochromia in iron deficiency and beta-thalassemia trait.
TLDR
Assessment of diagnostic usefulness of conventional and new RBC measurements provided by the H*1 demonstrated high sensitivity, specificity, and predictive value for the presence of iron-deficient erythropoiesis in patients with isolated iron deficiency, polycythemia vera treated by phlebotomy, and iron deficiency complicating heterozygous thalassemia.
Importance of RDW value in differential diagnosis of hypochrome anemias
TLDR
Red cell distribution width (RDW) was studied in adults carrying δ‐β thalassemia traits (δβ‐TT) and in controls with an age range of 20–40 years, and a significant rise in RDW in IDA 5–7 days after initiation of iron therapy was suggested as an important tool in differentiation of IDA from β‐TT.
New indices from the H*2 analyser improve differentiation between heterozygous β or δβ thalassaemia and iron‐deficiency anaemia
TLDR
The discriminant analysis, based on the minimization of Wilk's lambda (lambda) criterion, was used to select the best predictive variables to differentiate between IDA and THAL and has resulted in the highest diagnostic efficiency published to date.
Multivariable Discriminant Analysis for the Differential Diagnosis of Microcytic Anemia
TLDR
Investigating the performance of the multiple discriminant analysis (MDA) to the differential diagnosis of microcytic anemia found linear discriminant functions based on hemogram data can aid in differentiating between IDA and thalassemia, so samples can be efficiently selected for further analysis to confirm the presence of genetic anemia.
Red blood cell microcytosis and hypochromia in the differential diagnosis of iron deficiency and β‐thalassaemia trait
  • E. Urrechaga
  • Medicine, Biology
    International journal of laboratory hematology
  • 2009
TLDR
The aim of the study was to assess the predictive value of the new index % microcytic/% hypochromic ratio in the differential diagnosis of β‐thalassaemia compared with Mentzer index, currently used in the Laboratory.
Discriminant value of % microcytic/% hypochromic ratio in the differential diagnosis of microcytic anemia
  • E. Urrechaga
  • Medicine
    Clinical chemistry and laboratory medicine
  • 2008
TLDR
This index, with high sensitivity for β thalassemia screening, can be a useful tool in the differential diagnosis of microcytic anemia, so samples can be chosen for HbA2 analysis, to confirm the presumptive diagnosis of the disease.
[Hematometric values in delta-beta thalassemia minor. Special importance of the erythrocyte distribution in comparison with beta thalassemia and iron deficiency].
TLDR
The discrimination function described by England and Fraser may be of help in distinguishing these entities.
The clinical utility of discriminant functions for the differential diagnosis of microcytic anemias.
TLDR
MCHC and the difference between MCHC showed potential value as parameters for the differential diagnosis of iron deficiency from other causes of microcytic anemia, but it was noted that in 67% of the cases studied, the use of a DF could not have resolved the diagnosis to the extent that hemoglobin characterization and quantitation studies were no longer indicated.
Analysis of reticulocyte parameters on the Sysmex XE 5000 and LH 750 analyzers in the diagnosis of inefficient erythropoiesis
TLDR
Red blood cell size factor and Ret He are suitable parameters for the assessment of erythropoiesis status and its concordance with Ret He values is assessed.
...
1
2
3
4
...