• Publications
  • Influence
Structure of NADP+-bound 7β-hydroxysteroid dehydrogenase reveals two cofactor-binding modes.
TLDR
The first structure of NADP+ bound to dimeric 7β-HSDH is presented and provides a more detailed template to support rational protein engineering to improve the enzymatic activities of this useful biocatalyst, further improving the yield of ursodeoxycholic acid and its other applications. Expand
Characterization of a novel cytochrome P450 from Amycolatopsis sp. CGMCC1149 for hydroxylation of lovastatin
TLDR
A novel hydroxylase gene p450lov was isolated from Amycolatopsis sp. Expand
[Cloning and application of a novel hydroxylase in lovastatin conversion].
TLDR
The secondary structure prediction result showed that this protein contained many typical functional regions of P450, such as oxygen binding site, ion-pair region and heme binding region, which would be helpful for further studies in large-scale production of wuxistatin. Expand
3 SP 1 AACTTCCAGGCCGACTCCGCCCAGCTCATG 3 SP 2 CACGAAGACCTCACCATCGAGGAGCT 3 SP 3 ATCTTCTTCCGCTACGNNNNNNNNGACCTG 5 SP 1 GCCAGCAGCGAGATGATGACGGTCGACC 5 SP 2 ACGGACAGGTAGCGAAGCATTTCTTCCA 5 SP 3
Wuxistatin, a novel and potent statin, is converted from lovastatin by Amycolatopsis sp. CGMCC1149. In the bioconversion, lovastatin is firstly hydroxylated to 3-hydroxymethyl lovastatin (product I)Expand