Learn More
A selective kanamycin-binding single-strand DNA (ssDNA) aptamer (TGGGGGTTGAGGCTAAGCCGA) was discovered through in vitro selection using affinity chromatography with kanamycin-immobilized sepharose beads. The selected aptamer has a high affinity for kanamycin and also for kanamycin derivatives such as kanamycin B and tobramycin. The dissociation constants(More)
The functionalized calixarene derivatives exhibit remarkable properties towards organic and bioorganic molecules. However, the ability of calixarene derivatives to form stable complexes with biomolecules allows them to be applied for the development of biosensors and in the field of biology, biotechnology, and drug discovery. The applications of the(More)
One important factor in fabricating protein microarray is to immobilize proteins without losing their activity on a solid phase. To keep them functional, it is necessary to immobilize proteins in a way that preserve their folded structural integrity. In a previous study, we developed novel Calixarene derivatives for the immobilization of proteins on the(More)
We describe a novel HPV 9G DNA chip test for the accurate and reliable genotyping of human papillomavirus (HPV). The HPV 9G DNA chip test established its efficiency in terms of a signal-to-background ratio (SBR) of 200, which is 50 times superior to commercial HPV DNA chips, and 100% target-specific hybridization at 25°C. We compared the genotyping results(More)
We introduce the phenomenon of molecular recognition to immobilize oligonucleotides on AMCA slides for the production of 9G DNAChips. Facile and efficient method for the immobilization of the oligonucleotides appended with consecutive nine guanine bases is described. The 9G DNAChips shows more than 90% hybridization efficiency at 25 °C in 30 min.
The flaws in the present probe selection methods restrained the development of the DNA chip technology and its applications. The presented generalized probe selection method for the DNA chips elaborates the length of the probe, the melting temperatures, the specificity of the probe, and the position where the probe may bind to the targets.
Biomarkers play a vital role in disease detection and treatment follow-up. It is important to note that diseases in the early stage are typically treated with the greatest probability of success. However, due to various technical difficulties in current technologies for the detection of biomarkers, the potential of biomarkers is not explored completely.(More)
The novel HPV 9G DNAChips were developed for the detection and discrimination of the HPV genotypes in the clinical samples. The HPV 9G DNAChip established high SBR of 50-70 and 100% target-specific hybridization after 30min hybridization and 2×2min washing at 25°C. We compared the genotyping results of the 959 HPV positive and 82 HPV negative clinical(More)
The high SNP discrimination ratio of 360 : 1, 100% target-specific hybridization at 25 °C, detection limit of 10(1) copies, and differentiation of 10(1) to 10(7) copies of the PCR product of high-risk HPV genotypes in clinical samples ensure the application of the 9G membrane in a convenient platform for DNA genotyping.