Learn More
The applications of human pluripotent stem cell (hPSC)-derived cells in regenerative medicine has encountered a long-standing challenge: how can we efficiently obtain mature cell types from hPSCs? Attempts to address this problem are hindered by the complexity of controlling cell fate commitment and the lack of sufficient developmental knowledge for guiding(More)
Ambient temperature plays a large role in insect growth, development and even their distribution. The elucidation of the associated molecular mechanism that underlies the effect of constant high temperature will enables us to further understand the stress responses. We constructed four digital gene expression libraries from the fat body of female and male(More)
Chitin synthase (CHS) is the key regulatory enzyme in chitin synthesis and excretion in insects, and a specific target of insecticides. We cloned a CHS B gene of Bombyx mori (BmChsB) and showed it to be midgut specific, highly expressed during the feeding process in the larva. Knockdown of BmChsB expression in the third-instar larvae increased the number of(More)
Elevated extracellular free fatty acids (FFAs) can induce pancreatic beta cell apoptosis, thereby contributing to the pathogenesis of type 2 diabetes mellitus (T2D). Mitochondrial dysfunction has been implicated in FFA-induced beta cell apoptosis. However, molecular mechanisms linking mitochondrial dysfunction and FFA-induced beta cell apoptosis are not(More)
The calcium-regulated transcription coactivator, Ca(2)(+)-responsive transactivator (CREST) was expressed in pancreatic β-cells. Moreover, CREST expression became significantly increased in pancreatic islets isolated from hyperglycemic Goto-Kakizaki rats compared with normoglycemic Wistar controls. In addition, culture of β-cells in the presence of high(More)
Pancreatic islet transplantation is an effective treatment for diabetes mellitus. But it is not clear whether α-cell loss during islets isolation could impair the insulin release from β-cell. To unravel this issue, human islets with α-cell deficiency were prepared by prolonged enzyme digestion, as confirmed by immunocytochemistry, immunofluorescence(More)
We found that TRIB3, [corrected] an endogenous inhibitor of Akt (PKB), is expressed in pancreatic beta-cells. The TRIB3 [corrected] expression is significantly increased in islets isolated from hyperglycemic Goto-Kakizaki rats compared with normal glycemic controls. In vitro high glucose treatment also resulted in increased TRIB3 [corrected] expression in(More)
Elucidating the mechanisms underlying the response and resistance to high-temperature stress in the Lepidoptera is essential for understanding the effect of high-temperature on the regulation of gene expression. A tag (CATGAACGTGAAGAGATTCAG) matching the predicted gene BGIBMGA005823-TA in SilkDB identified the most significant response to high-temperature(More)
Diapause in Bombyx mori eggs is induced by temperature and photoperiod at the stage of embryonic development in the maternal generation. In those diapause eggs, Esterase-A4 is suggested to serve as a diapause-termination timer (TIME-EA4), because its ATPase activity shows an interval-timer elevation after acid treatment or chilling of eggs to break(More)
Pancreatic β-cell dysfunction is a critical component in the pathogenesis of diabetes. Endoplasmic reticulum (ER) stress is one of the factors that induces pancreatic β-cell dysfunction, but the underlying mechanisms have not been well elucidated. In this study, we report that a mitochondrial fission modulator, dynamin-related protein 1 (DRP-1), plays an(More)